Incidental Mutation 'R2217:Olfr1217'
List |< first << previous [record 24 of 46] next >> last >|
ID241193
Institutional Source Beutler Lab
Gene Symbol Olfr1217
Ensembl Gene ENSMUSG00000101391
Gene Nameolfactory receptor 1217
SynonymsMOR233-4, GA_x6K02T2Q125-50504545-50503631
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89021336-89032065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89023426 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 192 (H192Q)
Ref Sequence ENSEMBL: ENSMUSP00000149931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099799] [ENSMUST00000213669] [ENSMUST00000214022] [ENSMUST00000216592]
Predicted Effect probably benign
Transcript: ENSMUST00000099799
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097387
Gene: ENSMUSG00000101391
AA Change: H192Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-48 PFAM
Pfam:7tm_1 39 286 6.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213669
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000214022
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216592
AA Change: H192Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.3954 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Olfr1217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr1217 APN 2 89023175 missense probably benign 0.00
IGL02034:Olfr1217 APN 2 89023671 missense probably benign 0.07
IGL03328:Olfr1217 APN 2 89023855 nonsense probably null
R0153:Olfr1217 UTSW 2 89023196 missense probably benign 0.00
R0414:Olfr1217 UTSW 2 89023146 missense probably damaging 1.00
R0544:Olfr1217 UTSW 2 89023826 missense probably damaging 1.00
R1994:Olfr1217 UTSW 2 89023143 missense probably damaging 1.00
R3738:Olfr1217 UTSW 2 89023610 missense probably damaging 1.00
R3794:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3808:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R3809:Olfr1217 UTSW 2 89023426 missense probably benign 0.41
R5252:Olfr1217 UTSW 2 89023254 missense probably damaging 0.98
R5448:Olfr1217 UTSW 2 89023501 missense probably benign
R7524:Olfr1217 UTSW 2 89023971 missense probably benign 0.01
R8031:Olfr1217 UTSW 2 89023628 missense probably damaging 1.00
Z1176:Olfr1217 UTSW 2 89023795 missense possibly damaging 0.60
Z1176:Olfr1217 UTSW 2 89023896 missense probably damaging 1.00
Z1177:Olfr1217 UTSW 2 89023440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGCAGAAGTAGGTCTTGC -3'
(R):5'- TATGTGGCCATTTGCAAGCC -3'

Sequencing Primer
(F):5'- TGGGCTCTCAGAGAAAAC -3'
(R):5'- TCTTCCATCATGACCCAGAGG -3'
Posted On2014-10-15