Incidental Mutation 'R2217:Slc27a2'
List |< first << previous [record 34 of 46] next >> last >|
ID241194
Institutional Source Beutler Lab
Gene Symbol Slc27a2
Ensembl Gene ENSMUSG00000027359
Gene Namesolute carrier family 27 (fatty acid transporter), member 2
SynonymsVLCS, ACSVL1, Vlac, FATP2, FATP2, Vlacs
MMRRC Submission 040219-MU
Accession Numbers

Genbank: NM_011978.2 ; Ensembl: ENSMUST00000061491, ENSMUST00000141482, ENSMUST00000126249, ENSMUST00000150947

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126552407-126588243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126567752 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000057595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061491] [ENSMUST00000141482]
Predicted Effect probably damaging
Transcript: ENSMUST00000061491
AA Change: T285A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057595
Gene: ENSMUSG00000027359
AA Change: T285A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 41 53 N/A INTRINSIC
Pfam:AMP-binding 59 488 1.4e-71 PFAM
Pfam:AMP-binding_C 496 572 1.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126249
Predicted Effect possibly damaging
Transcript: ENSMUST00000141482
AA Change: T149A

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117145
Gene: ENSMUSG00000027359
AA Change: T149A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 256 6.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150947
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Slc27a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc27a2 APN 2 126580917 missense probably damaging 1.00
IGL01907:Slc27a2 APN 2 126587874 missense probably benign 0.02
IGL02185:Slc27a2 APN 2 126567816 missense probably damaging 0.99
IGL02363:Slc27a2 APN 2 126578950 missense possibly damaging 0.58
IGL02451:Slc27a2 APN 2 126578992 missense probably benign 0.00
IGL02486:Slc27a2 APN 2 126553350 missense probably benign 0.00
IGL03217:Slc27a2 APN 2 126586252 missense possibly damaging 0.80
IGL03287:Slc27a2 APN 2 126553392 missense probably damaging 1.00
IGL03291:Slc27a2 APN 2 126564750 missense probably benign 0.14
baseboard UTSW 2 126567780 missense probably damaging 0.97
B6584:Slc27a2 UTSW 2 126561642 missense possibly damaging 0.94
R0021:Slc27a2 UTSW 2 126567886 splice site probably benign
R0647:Slc27a2 UTSW 2 126587916 missense probably benign 0.00
R1326:Slc27a2 UTSW 2 126564770 missense probably damaging 1.00
R1509:Slc27a2 UTSW 2 126553314 missense possibly damaging 0.95
R1907:Slc27a2 UTSW 2 126586342 missense probably benign 0.13
R2012:Slc27a2 UTSW 2 126553615 missense probably damaging 0.98
R3769:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R3770:Slc27a2 UTSW 2 126567798 missense possibly damaging 0.90
R5244:Slc27a2 UTSW 2 126578855 missense probably benign 0.00
R5459:Slc27a2 UTSW 2 126580992 missense probably damaging 0.98
R5582:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5606:Slc27a2 UTSW 2 126564690 missense probably damaging 1.00
R5655:Slc27a2 UTSW 2 126578939 missense probably damaging 1.00
R5680:Slc27a2 UTSW 2 126561610 missense probably benign 0.02
R5747:Slc27a2 UTSW 2 126564738 missense probably benign
R6346:Slc27a2 UTSW 2 126587880 missense probably damaging 0.97
R7042:Slc27a2 UTSW 2 126567780 missense probably damaging 0.97
R7297:Slc27a2 UTSW 2 126578946 missense probably damaging 0.99
R7323:Slc27a2 UTSW 2 126553204 missense probably benign 0.38
R7391:Slc27a2 UTSW 2 126553162 missense unknown
R8247:Slc27a2 UTSW 2 126553595 missense probably benign 0.01
RF008:Slc27a2 UTSW 2 126553255 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAATGATTCTCCATGCACCTTC -3'
(R):5'- AGTGTGTCATCAGGCATGTTAC -3'

Sequencing Primer
(F):5'- ATGCACCTTCTCCTCTTCCATAGG -3'
(R):5'- CGAGATCCCAGGAGTCTTGAATATC -3'
Posted On2014-10-15