Incidental Mutation 'R2217:Pank2'
ID 241196
Institutional Source Beutler Lab
Gene Symbol Pank2
Ensembl Gene ENSMUSG00000037514
Gene Name pantothenate kinase 2
Synonyms 4933409I19Rik
MMRRC Submission 040219-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R2217 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 131104415-131141108 bp(+) (GRCm39)
Type of Mutation splice site (8418 bp from exon)
DNA Base Change (assembly) A to G at 131124601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000150843] [ENSMUST00000184932] [ENSMUST00000184105]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138509
Predicted Effect probably null
Transcript: ENSMUST00000145904
SMART Domains Protein: ENSMUSP00000115034
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
Pfam:Fumble 11 128 5.1e-21 PFAM
Pfam:Fumble 121 178 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150843
AA Change: D315G

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119606
Gene: ENSMUSG00000037514
AA Change: D315G

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 86 438 8.8e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183349
AA Change: D56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000183388
Predicted Effect probably benign
Transcript: ENSMUST00000184932
SMART Domains Protein: ENSMUSP00000139259
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 151 1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184105
SMART Domains Protein: ENSMUSP00000138992
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 154 7.2e-13 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrested spermatogenesis, azoospermia, reduced female fertility, and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 112,709,128 (GRCm39) K232E probably benign Het
Apba1 T C 19: 23,871,326 (GRCm39) M386T probably damaging Het
Appl2 G T 10: 83,444,601 (GRCm39) F472L possibly damaging Het
Atxn2 T C 5: 121,941,140 (GRCm39) Y56H probably damaging Het
Cacna1c T C 6: 118,647,368 (GRCm39) Y809C probably damaging Het
Canx C T 11: 50,201,694 (GRCm39) V59I probably benign Het
Catsperb T C 12: 101,560,478 (GRCm39) L823P probably damaging Het
Crb3 T C 17: 57,372,090 (GRCm39) S46P probably benign Het
Daam1 G A 12: 72,036,601 (GRCm39) R1058H probably damaging Het
Ehd1 T A 19: 6,348,502 (GRCm39) D493E probably damaging Het
Eml6 T A 11: 29,768,907 (GRCm39) Q746L probably damaging Het
Epg5 T A 18: 77,992,287 (GRCm39) M328K probably benign Het
Flt4 T A 11: 49,515,555 (GRCm39) S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm7535 A G 17: 18,131,936 (GRCm39) probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Hmcn2 A T 2: 31,240,586 (GRCm39) T494S probably benign Het
Hydin G A 8: 111,145,138 (GRCm39) V830I probably benign Het
Map3k6 T A 4: 132,973,983 (GRCm39) H487Q possibly damaging Het
Myh14 G A 7: 44,283,800 (GRCm39) P735S probably damaging Het
Nfkb2 T C 19: 46,296,163 (GRCm39) probably null Het
Nlrp4c T C 7: 6,076,113 (GRCm39) V671A probably benign Het
Nsrp1 A T 11: 76,936,587 (GRCm39) Y536* probably null Het
Or4c112 G T 2: 88,853,770 (GRCm39) H192Q probably benign Het
Pak5 A G 2: 135,958,123 (GRCm39) S322P probably damaging Het
Phf6 A T X: 52,031,525 (GRCm39) I272F probably damaging Het
Plxna2 T C 1: 194,480,056 (GRCm39) L1409P probably damaging Het
Polr2a A G 11: 69,633,511 (GRCm39) probably null Het
Pp2d1 C A 17: 53,822,482 (GRCm39) V195L probably benign Het
Psma1 C T 7: 113,864,173 (GRCm39) E227K unknown Het
Ptger1 C T 8: 84,395,357 (GRCm39) T278I probably benign Het
Slc20a2 C A 8: 23,050,532 (GRCm39) S250R probably benign Het
Slc27a2 A G 2: 126,409,672 (GRCm39) T285A probably damaging Het
Slc47a2 T C 11: 61,204,497 (GRCm39) T285A probably benign Het
Slf1 T A 13: 77,194,825 (GRCm39) probably null Het
Tiam2 A G 17: 3,465,389 (GRCm39) T373A probably benign Het
Timd2 T A 11: 46,577,844 (GRCm39) I96L probably damaging Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Tmem64 T C 4: 15,266,658 (GRCm39) I236T possibly damaging Het
Trpm2 T A 10: 77,777,016 (GRCm39) D427V probably damaging Het
Vax2 A T 6: 83,714,871 (GRCm39) Y262F probably damaging Het
Virma T C 4: 11,544,924 (GRCm39) S1628P probably damaging Het
Zan C A 5: 137,408,568 (GRCm39) probably benign Het
Zbtb22 T G 17: 34,136,939 (GRCm39) D361E probably damaging Het
Zfp27 A G 7: 29,595,536 (GRCm39) L143P possibly damaging Het
Other mutations in Pank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pank2 APN 2 131,116,089 (GRCm39) missense possibly damaging 0.69
R0242:Pank2 UTSW 2 131,122,117 (GRCm39) missense probably damaging 1.00
R0242:Pank2 UTSW 2 131,122,117 (GRCm39) missense probably damaging 1.00
R0492:Pank2 UTSW 2 131,122,180 (GRCm39) missense probably damaging 1.00
R0513:Pank2 UTSW 2 131,124,526 (GRCm39) missense probably damaging 1.00
R1415:Pank2 UTSW 2 131,124,638 (GRCm39) nonsense probably null
R1622:Pank2 UTSW 2 131,115,889 (GRCm39) missense probably damaging 1.00
R4690:Pank2 UTSW 2 131,115,945 (GRCm39) missense probably damaging 1.00
R4691:Pank2 UTSW 2 131,138,201 (GRCm39) missense possibly damaging 0.85
R5387:Pank2 UTSW 2 131,116,182 (GRCm39) missense probably benign 0.24
R6175:Pank2 UTSW 2 131,122,181 (GRCm39) nonsense probably null
R6806:Pank2 UTSW 2 131,104,627 (GRCm39) unclassified probably benign
R6848:Pank2 UTSW 2 131,124,546 (GRCm39) missense probably damaging 0.98
R7010:Pank2 UTSW 2 131,122,293 (GRCm39) missense probably benign
R7467:Pank2 UTSW 2 131,115,967 (GRCm39) missense possibly damaging 0.53
R7723:Pank2 UTSW 2 131,122,258 (GRCm39) missense probably damaging 1.00
R8504:Pank2 UTSW 2 131,135,320 (GRCm39) missense probably benign 0.00
R8905:Pank2 UTSW 2 131,124,646 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATTTAATTGAGGCAAGAGTAGCTG -3'
(R):5'- CTCAGTTTATGCACTGCCGG -3'

Sequencing Primer
(F):5'- TGGGGGTTCATAAGTCCA -3'
(R):5'- GGGGACCGTGTACACTAGTAC -3'
Posted On 2014-10-15