Incidental Mutation 'R2217:Pak7'
List |< first << previous [record 25 of 46] next >> last >|
ID241197
Institutional Source Beutler Lab
Gene Symbol Pak7
Ensembl Gene ENSMUSG00000039913
Gene Namep21 (RAC1) activated kinase 7
Synonyms2900083L08Rik, Pak5
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location136081104-136387967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136116203 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 322 (S322P)
Ref Sequence ENSEMBL: ENSMUSP00000076440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035264] [ENSMUST00000077200]
Predicted Effect probably damaging
Transcript: ENSMUST00000035264
AA Change: S322P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047285
Gene: ENSMUSG00000039913
AA Change: S322P

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077200
AA Change: S322P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076440
Gene: ENSMUSG00000039913
AA Change: S322P

DomainStartEndE-ValueType
PBD 11 46 5.3e-13 SMART
low complexity region 394 415 N/A INTRINSIC
S_TKc 449 700 1.39e-90 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PAK family of Ser/Thr protein kinases. PAK family members are known to be effectors of Rac/Cdc42 GTPases, which have been implicated in the regulation of cytoskeletal dynamics, proliferation, and cell survival signaling. This kinase contains a CDC42/Rac1 interactive binding (CRIB) motif, and has been shown to bind CDC42 in the presence of GTP. This kinase is predominantly expressed in brain. It is capable of promoting neurite outgrowth, and thus may play a role in neurite development. This kinase is associated with microtubule networks and induces microtubule stabilization. The subcellular localization of this kinase is tightly regulated during cell cycle progression. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit impaired active avoidance learning but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Pak7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Pak7 APN 2 136116373 missense possibly damaging 0.89
IGL01743:Pak7 APN 2 136087413 missense probably damaging 1.00
IGL02601:Pak7 APN 2 136116935 nonsense probably null
IGL03172:Pak7 APN 2 136098390 nonsense probably null
currency UTSW 2 136100939 missense probably benign 0.15
Depreciation UTSW 2 136097534 missense probably damaging 1.00
PIT4498001:Pak7 UTSW 2 136083291 missense probably damaging 1.00
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0025:Pak7 UTSW 2 136100784 missense possibly damaging 0.68
R0400:Pak7 UTSW 2 136097579 missense possibly damaging 0.95
R0441:Pak7 UTSW 2 136116629 missense probably benign
R1653:Pak7 UTSW 2 136116887 missense probably damaging 1.00
R1662:Pak7 UTSW 2 136116760 missense probably damaging 0.96
R1855:Pak7 UTSW 2 136087509 missense probably benign 0.00
R1872:Pak7 UTSW 2 136085588 missense possibly damaging 0.93
R2001:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2002:Pak7 UTSW 2 136116637 missense probably benign 0.00
R2157:Pak7 UTSW 2 136100957 missense probably damaging 0.96
R2160:Pak7 UTSW 2 136098382 missense probably benign 0.01
R3797:Pak7 UTSW 2 136100826 missense probably benign 0.06
R4711:Pak7 UTSW 2 136087517 missense probably damaging 1.00
R4904:Pak7 UTSW 2 136083347 missense probably benign 0.02
R5090:Pak7 UTSW 2 136087418 missense probably damaging 1.00
R5120:Pak7 UTSW 2 136083229 missense probably damaging 0.97
R5669:Pak7 UTSW 2 136116284 missense probably damaging 1.00
R5954:Pak7 UTSW 2 136116463 missense probably benign 0.01
R6127:Pak7 UTSW 2 136087406 missense probably damaging 0.99
R6250:Pak7 UTSW 2 136174269 start gained probably benign
R6471:Pak7 UTSW 2 136116190 missense probably benign 0.00
R6797:Pak7 UTSW 2 136097534 missense probably damaging 1.00
R6809:Pak7 UTSW 2 136097581 missense possibly damaging 0.83
R6945:Pak7 UTSW 2 136100939 missense probably benign 0.15
R7254:Pak7 UTSW 2 136116764 missense possibly damaging 0.50
R7265:Pak7 UTSW 2 136101185 missense probably benign 0.03
R7335:Pak7 UTSW 2 136098299 missense probably damaging 1.00
R7511:Pak7 UTSW 2 136083324 missense possibly damaging 0.87
R7573:Pak7 UTSW 2 136116305 missense probably damaging 1.00
R7593:Pak7 UTSW 2 136100964 missense probably benign 0.40
R7908:Pak7 UTSW 2 136116559 missense probably benign 0.14
R8304:Pak7 UTSW 2 136098283 missense probably benign 0.11
Z1176:Pak7 UTSW 2 136083246 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGTAATAGATCCCCAAAGCC -3'
(R):5'- TATGACAGGAGGCCAAAATCATC -3'

Sequencing Primer
(F):5'- GACATATGGACCTTGTTTTAAAGCC -3'
(R):5'- TCATCATACCTGCATCAGACGAG -3'
Posted On2014-10-15