Incidental Mutation 'R2217:Atxn2'
List |< first << previous [record 4 of 46] next >> last >|
ID241202
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Nameataxin 2
Synonyms9630045M23Rik, ATX2, Sca2
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location121711337-121816493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121803077 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 56 (Y56H)
Ref Sequence ENSEMBL: ENSMUSP00000123833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327]
Predicted Effect probably damaging
Transcript: ENSMUST00000051950
AA Change: Y1078H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: Y1078H

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160093
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161064
AA Change: Y769H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: Y769H

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161159
AA Change: Y56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605
AA Change: Y56H

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161872
Predicted Effect probably damaging
Transcript: ENSMUST00000162327
AA Change: Y472H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: Y472H

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199451
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121795055 missense probably benign 0.00
IGL00798:Atxn2 APN 5 121795235 missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121810979 missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121797344 missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121806268 nonsense probably null
IGL02122:Atxn2 APN 5 121778030 missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121781387 missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121781336 missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121810909 missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121785235 missense probably benign 0.00
R0387:Atxn2 UTSW 5 121802143 missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121772778 missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121747421 unclassified probably null
R1305:Atxn2 UTSW 5 121749184 missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121803082 critical splice donor site probably null
R1471:Atxn2 UTSW 5 121786374 missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121779591 missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121802108 missense probably damaging 0.99
R1528:Atxn2 UTSW 5 121813530 missense probably damaging 1.00
R2083:Atxn2 UTSW 5 121784006 missense probably benign 0.00
R2197:Atxn2 UTSW 5 121806217 splice site probably null
R2218:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121781393 missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121785868 critical splice donor site probably null
R4604:Atxn2 UTSW 5 121781343 missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121814411 missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121749096 missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121814343 missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121795035 unclassified probably null
R5213:Atxn2 UTSW 5 121814480 unclassified probably null
R5655:Atxn2 UTSW 5 121747426 missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121813449 missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121797310 missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121810992 missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121779432 missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121811614 critical splice donor site probably null
R6659:Atxn2 UTSW 5 121777964 missense probably benign 0.10
R6864:Atxn2 UTSW 5 121779494 missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121811467 nonsense probably null
R7166:Atxn2 UTSW 5 121796397 missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121778021 missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121785817 missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121802267 critical splice donor site probably null
R7544:Atxn2 UTSW 5 121781368 missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121796377 missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121802117 missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121749223 missense probably damaging 1.00
X0028:Atxn2 UTSW 5 121802083 missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121777990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTTATCTAGACTTCACATCGTTC -3'
(R):5'- CCCTTGTTTTCTAAGGTAGAGTCTC -3'

Sequencing Primer
(F):5'- CACATCGTTCATTTTGGCATAATGG -3'
(R):5'- GGTAGAGTCTCTATGTTGTCTCTCAC -3'
Posted On2014-10-15