Incidental Mutation 'R2217:Vax2'
List |< first << previous [record 42 of 46] next >> last >|
ID241205
Institutional Source Beutler Lab
Gene Symbol Vax2
Ensembl Gene ENSMUSG00000034777
Gene Nameventral anterior homeobox 2
Synonyms
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83711264-83738313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83737889 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 262 (Y262F)
Ref Sequence ENSEMBL: ENSMUSP00000035976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037807]
Predicted Effect probably damaging
Transcript: ENSMUST00000037807
AA Change: Y262F

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035976
Gene: ENSMUSG00000034777
AA Change: Y262F

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
HOX 102 164 3.54e-27 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 233 247 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox protein and is almost exclusively expressed in the ventral portion of the retina during development. In mouse studies, this gene was found to be required for the correct formation of the optic fissure and other aspects of retinal development. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null mutants for one allele show incomplete closure of optic fissure leading to coloboma, the frequency of which is strongly influenced by genetic background. Homozygous null mutants for 2 different alleles have abnormal projections of ventralretinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Vax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Vax2 APN 6 83711537 missense possibly damaging 0.70
IGL02161:Vax2 APN 6 83737903 missense probably damaging 1.00
IGL02584:Vax2 APN 6 83711513 missense probably benign
R0316:Vax2 UTSW 6 83711444 missense possibly damaging 0.79
R0456:Vax2 UTSW 6 83711406 missense probably benign 0.00
R1006:Vax2 UTSW 6 83737777 missense probably damaging 1.00
R2045:Vax2 UTSW 6 83711270 start gained probably benign
R2324:Vax2 UTSW 6 83711325 missense possibly damaging 0.53
R3979:Vax2 UTSW 6 83737547 missense probably damaging 0.98
R4755:Vax2 UTSW 6 83711397 missense probably damaging 0.99
R7203:Vax2 UTSW 6 83737900 missense probably damaging 0.99
R7242:Vax2 UTSW 6 83711316 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CAAGGTGAAGGTCTGGTTCC -3'
(R):5'- CTGCTCAGTATAGTCCACGG -3'

Sequencing Primer
(F):5'- TCCTGCGGCTTCTGGAAC -3'
(R):5'- TATAGTCCACGGGGGCCAG -3'
Posted On2014-10-15