Incidental Mutation 'R2217:Slc20a2'
ID 241212
Institutional Source Beutler Lab
Gene Symbol Slc20a2
Ensembl Gene ENSMUSG00000037656
Gene Name solute carrier family 20, member 2
Synonyms PiT-2, MolPit2, Ram-1, Ram1, Pit-2
MMRRC Submission 040219-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R2217 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 22476788-22569612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 22560516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 250 (S250R)
Ref Sequence ENSEMBL: ENSMUSP00000065935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067786]
AlphaFold Q80UP8
Predicted Effect probably benign
Transcript: ENSMUST00000067786
AA Change: S250R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065935
Gene: ENSMUSG00000037656
AA Change: S250R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PHO4 24 638 1.6e-160 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inorganic phosphate transporter family. The encoded protein is a type 3 sodium-dependent phosphate symporter that plays an important role in phosphate homeostasis by mediating cellular phosphate uptake. The encoded protein also confers susceptibility to viral infection as a gamma-retroviral receptor. Mutations in this gene may play a role in familial idiopathic basal ganglia calcification. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit brain calcifications in the thalamus, basal ganglia and cerebral cortex, microgliosis, and a high inorganic phosphate concentration [Pi] in cerebrospinal fluid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Slc20a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Slc20a2 APN 8 22535557 missense possibly damaging 0.66
IGL03248:Slc20a2 APN 8 22558983 missense probably benign 0.05
PIT4453001:Slc20a2 UTSW 8 22535382 missense probably damaging 1.00
R0015:Slc20a2 UTSW 8 22535345 missense probably damaging 1.00
R0015:Slc20a2 UTSW 8 22535345 missense probably damaging 1.00
R0385:Slc20a2 UTSW 8 22568393 missense probably benign 0.10
R1679:Slc20a2 UTSW 8 22538830 missense possibly damaging 0.87
R1737:Slc20a2 UTSW 8 22545566 missense probably damaging 1.00
R1966:Slc20a2 UTSW 8 22545537 missense probably damaging 1.00
R3821:Slc20a2 UTSW 8 22538902 missense probably benign
R3878:Slc20a2 UTSW 8 22568383 missense possibly damaging 0.91
R4284:Slc20a2 UTSW 8 22561349 missense probably benign
R4285:Slc20a2 UTSW 8 22561349 missense probably benign
R4915:Slc20a2 UTSW 8 22561004 missense probably damaging 1.00
R4916:Slc20a2 UTSW 8 22561004 missense probably damaging 1.00
R4918:Slc20a2 UTSW 8 22561004 missense probably damaging 1.00
R4938:Slc20a2 UTSW 8 22561205 missense possibly damaging 0.69
R6374:Slc20a2 UTSW 8 22565652 missense possibly damaging 0.94
R6894:Slc20a2 UTSW 8 22560593 missense possibly damaging 0.70
R7369:Slc20a2 UTSW 8 22561400 missense probably benign 0.08
R7756:Slc20a2 UTSW 8 22535492 missense probably damaging 1.00
R7889:Slc20a2 UTSW 8 22540401 missense probably damaging 1.00
R8971:Slc20a2 UTSW 8 22540380 missense probably damaging 1.00
R9110:Slc20a2 UTSW 8 22535441 missense probably damaging 0.98
R9145:Slc20a2 UTSW 8 22540431 missense probably benign 0.00
R9433:Slc20a2 UTSW 8 22561195 nonsense probably null
R9649:Slc20a2 UTSW 8 22538884 missense probably damaging 1.00
R9778:Slc20a2 UTSW 8 22561391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCGTAAGTACTGACCATCAAC -3'
(R):5'- AGCCTTACCATAGGAAGCCC -3'

Sequencing Primer
(F):5'- GTACTGACCATCAACTGTCTTCAAG -3'
(R):5'- TACCATAGGAAGCCCGGGGG -3'
Posted On 2014-10-15