Incidental Mutation 'R2217:Ptger1'
List |< first << previous [record 32 of 46] next >> last >|
ID241215
Institutional Source Beutler Lab
Gene Symbol Ptger1
Ensembl Gene ENSMUSG00000019464
Gene Nameprostaglandin E receptor 1 (subtype EP1)
SynonymsEP1, 42kDa, Ptgerep1
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2217 (G1)
Quality Score174
Status Not validated
Chromosome8
Chromosomal Location83666678-83672753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83668728 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 278 (T278I)
Ref Sequence ENSEMBL: ENSMUSP00000019608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005616] [ENSMUST00000019577] [ENSMUST00000019608] [ENSMUST00000132945] [ENSMUST00000144258]
Predicted Effect probably benign
Transcript: ENSMUST00000005616
SMART Domains Protein: ENSMUSP00000005616
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Hr1 37 101 6.74e-20 SMART
Hr1 126 194 1.13e-21 SMART
Hr1 216 284 7.79e-25 SMART
C2 328 464 2.45e-1 SMART
low complexity region 569 601 N/A INTRINSIC
S_TKc 619 878 2.83e-96 SMART
S_TK_X 879 943 5.29e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019577
SMART Domains Protein: ENSMUSP00000019577
Gene: ENSMUSG00000019433

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
PDZ 141 215 9.07e-13 SMART
low complexity region 236 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019608
AA Change: T278I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000019608
Gene: ENSMUSG00000019464
AA Change: T278I

DomainStartEndE-ValueType
Pfam:7tm_1 52 354 2.3e-17 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128523
Predicted Effect probably benign
Transcript: ENSMUST00000132945
SMART Domains Protein: ENSMUSP00000115054
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Hr1 49 113 6.74e-20 SMART
Hr1 138 206 1.13e-21 SMART
Hr1 228 296 7.79e-25 SMART
C2 340 476 2.45e-1 SMART
low complexity region 581 613 N/A INTRINSIC
Pfam:Pkinase 631 756 2.2e-23 PFAM
Pfam:Pkinase_Tyr 631 757 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138898
Predicted Effect probably benign
Transcript: ENSMUST00000144258
SMART Domains Protein: ENSMUSP00000116235
Gene: ENSMUSG00000057672

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Hr1 42 106 6.74e-20 SMART
Hr1 131 199 1.13e-21 SMART
Hr1 221 289 7.79e-25 SMART
C2 333 469 2.45e-1 SMART
low complexity region 574 606 N/A INTRINSIC
S_TKc 624 883 2.83e-96 SMART
S_TK_X 884 948 5.29e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212519
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). Through a phosphatidylinositol-calcium second messenger system, G-Q proteins mediate this receptor's activity. Knockout studies in mice suggested a role of this receptor in mediating algesia and in regulation of blood pressure. Studies in mice also suggested that this gene may mediate adrenocorticotropic hormone response to bacterial endotoxin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may exhibit partial prenatal lethality, pain threshold abnormalities, behavioral disinhibition in response to stress, low blood pressure, defects in type IV hypersensitivity reactions, resistance to chemically induced tumors and impaired response to water deprivation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Ptger1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01975:Ptger1 APN 8 83669520 unclassified probably benign
IGL02069:Ptger1 APN 8 83669457 missense probably benign
R0042:Ptger1 UTSW 8 83668166 missense probably benign 0.31
R0069:Ptger1 UTSW 8 83668319 missense possibly damaging 0.91
R1694:Ptger1 UTSW 8 83668478 missense probably benign 0.01
R1754:Ptger1 UTSW 8 83669297 missense probably benign 0.34
R1858:Ptger1 UTSW 8 83668478 missense probably benign 0.02
R1973:Ptger1 UTSW 8 83669454 missense probably benign 0.13
R5276:Ptger1 UTSW 8 83669345 missense possibly damaging 0.56
R5569:Ptger1 UTSW 8 83668332 unclassified probably null
R6822:Ptger1 UTSW 8 83668650 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTGTGCAATACGCTCAGC -3'
(R):5'- AAGGCTTGAGTGTGTGAGAC -3'

Sequencing Primer
(F):5'- TCGACGATTCCGAAAGAC -3'
(R):5'- GTGTGTGAGACTATTTACAGAGATCC -3'
Posted On2014-10-15