Incidental Mutation 'R2217:Adat1'
List [record 1 of 46] next >> last >|
ID241217
Institutional Source Beutler Lab
Gene Symbol Adat1
Ensembl Gene ENSMUSG00000031949
Gene Nameadenosine deaminase, tRNA-specific 1
SynonymsmADAT1
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111966908-111992302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111982496 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 232 (K232E)
Ref Sequence ENSEMBL: ENSMUSP00000117279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034427] [ENSMUST00000120457] [ENSMUST00000139820]
Predicted Effect probably benign
Transcript: ENSMUST00000034427
AA Change: K232E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034427
Gene: ENSMUSG00000031949
AA Change: K232E

DomainStartEndE-ValueType
ADEAMc 2 499 4.19e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120457
AA Change: K232E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113201
Gene: ENSMUSG00000031949
AA Change: K232E

DomainStartEndE-ValueType
Pfam:A_deamin 63 354 8.1e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139820
AA Change: K232E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117279
Gene: ENSMUSG00000031949
AA Change: K232E

DomainStartEndE-ValueType
ADEAMc 2 453 1e-141 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ADAR (adenosine deaminase acting on RNA) family. Using site-specific adenosine modification, proteins encoded by these genes participate in the pre-mRNA editing of nuclear transcripts. The protein encoded by this gene, tRNA-specific adenosine deaminase 1, is responsible for the deamination of adenosine 37 to inosine in eukaryotic tRNA. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Adat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Adat1 APN 8 111982310 missense probably damaging 1.00
R0212:Adat1 UTSW 8 111987208 missense possibly damaging 0.50
R0559:Adat1 UTSW 8 111982430 missense probably damaging 1.00
R1521:Adat1 UTSW 8 111987235 missense possibly damaging 0.66
R1972:Adat1 UTSW 8 111990418 unclassified probably benign
R3807:Adat1 UTSW 8 111990370 missense probably damaging 1.00
R4497:Adat1 UTSW 8 111979362 missense probably benign 0.06
R4553:Adat1 UTSW 8 111990280 missense probably damaging 1.00
R5702:Adat1 UTSW 8 111978072 missense probably benign 0.37
R5960:Adat1 UTSW 8 111982601 missense probably benign 0.00
R6380:Adat1 UTSW 8 111978072 missense probably benign 0.37
R6538:Adat1 UTSW 8 111968462 missense probably benign
R6907:Adat1 UTSW 8 111972161 missense probably benign
R7022:Adat1 UTSW 8 111989862 missense probably damaging 1.00
R7440:Adat1 UTSW 8 111989898 missense probably damaging 0.99
R7606:Adat1 UTSW 8 111982604 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCTTGTCACTGCAGGACATGG -3'
(R):5'- TCAGAAGTTGGGCCAACAAC -3'

Sequencing Primer
(F):5'- GGAGCATGTCCTGTCTCCC -3'
(R):5'- GTTGGGCCAACAACTCACCTG -3'
Posted On2014-10-15