Incidental Mutation 'R2217:Gm10608'
ID 241218
Institutional Source Beutler Lab
Gene Symbol Gm10608
Ensembl Gene ENSMUSG00000074029
Gene Name predicted gene 10608
Synonyms EG546165
MMRRC Submission 040219-MU
Accession Numbers

Genbank: XR_031269; Ensembl: ENSMUST00000093527; MGI: 3642009

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R2217 (G1)
Quality Score 163
Status Not validated
Chromosome 9
Chromosomal Location 119162652-119164087 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA to CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA at 119160716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010795] [ENSMUST00000093527]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000010795
SMART Domains Protein: ENSMUSP00000010795
Gene: ENSMUSG00000010651

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 6.7e-90 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000093527
SMART Domains Protein: ENSMUSP00000091246
Gene: ENSMUSG00000074029

DomainStartEndE-ValueType
Pfam:DUF3915 11 80 3.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213924
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Gm10608
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Gm10608 UTSW 9 119161088 unclassified probably benign
R1023:Gm10608 UTSW 9 119160716 small deletion probably benign
R1053:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1148:Gm10608 UTSW 9 119160716 frame shift probably null
R1167:Gm10608 UTSW 9 119160716 frame shift probably null
R1172:Gm10608 UTSW 9 119160716 frame shift probably null
R1211:Gm10608 UTSW 9 119160712 frame shift probably null
R1601:Gm10608 UTSW 9 119160716 frame shift probably null
R1743:Gm10608 UTSW 9 119160716 small deletion probably benign
R1766:Gm10608 UTSW 9 119160716 frame shift probably null
R1939:Gm10608 UTSW 9 119160716 frame shift probably null
R2016:Gm10608 UTSW 9 119160716 small deletion probably benign
R2127:Gm10608 UTSW 9 119160716 small deletion probably benign
R2270:Gm10608 UTSW 9 119160716 frame shift probably null
R2372:Gm10608 UTSW 9 119160716 small deletion probably benign
R2844:Gm10608 UTSW 9 119160716 frame shift probably null
R2959:Gm10608 UTSW 9 119160716 frame shift probably null
R2968:Gm10608 UTSW 9 119160716 small deletion probably benign
R3084:Gm10608 UTSW 9 119160716 frame shift probably null
R3607:Gm10608 UTSW 9 119160716 small deletion probably benign
R3702:Gm10608 UTSW 9 119160716 frame shift probably null
R3779:Gm10608 UTSW 9 119160716 small deletion probably benign
R3839:Gm10608 UTSW 9 119160716 frame shift probably null
R3900:Gm10608 UTSW 9 119160716 frame shift probably null
R3947:Gm10608 UTSW 9 119160662 small deletion probably benign
R4015:Gm10608 UTSW 9 119160716 frame shift probably null
R4024:Gm10608 UTSW 9 119160716 small deletion probably benign
R5346:Gm10608 UTSW 9 119160724 frame shift probably null
R8225:Gm10608 UTSW 9 119160708 frame shift probably null
X0065:Gm10608 UTSW 9 119160863 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGACAGGTGCCACAACAG -3'
(R):5'- GCCTCTTCATAGGTCACATGCC -3'

Sequencing Primer
(F):5'- GTGCCACAACAGGGCAG -3'
(R):5'- TCAGATGGCAAAGCTTCCTG -3'
Posted On 2014-10-15