Incidental Mutation 'R2217:Appl2'
List |< first << previous [record 3 of 46] next >> last >|
ID241220
Institutional Source Beutler Lab
Gene Symbol Appl2
Ensembl Gene ENSMUSG00000020263
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
SynonymsDip3b
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location83600033-83648738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83608737 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 472 (F472L)
Ref Sequence ENSEMBL: ENSMUSP00000020500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020500]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020500
AA Change: F472L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020500
Gene: ENSMUSG00000020263
AA Change: F472L

DomainStartEndE-ValueType
Pfam:BAR_3 7 248 6.4e-69 PFAM
PH 278 377 1.2e-7 SMART
Pfam:PTB 491 613 6e-7 PFAM
Pfam:PID 492 611 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150351
Predicted Effect probably benign
Transcript: ENSMUST00000176675
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele display altered red blood cell physiology. Mutant MEFs exhibit defects in HGF-induced Akt activation, migration, and invasion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Appl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Appl2 APN 10 83614301 missense possibly damaging 0.95
IGL01794:Appl2 APN 10 83614294 missense probably benign
IGL01887:Appl2 APN 10 83621522 unclassified probably benign
IGL03071:Appl2 APN 10 83641106 critical splice acceptor site probably null
IGL03077:Appl2 APN 10 83621759 unclassified probably benign
R0006:Appl2 UTSW 10 83602898 missense probably damaging 1.00
R0006:Appl2 UTSW 10 83602898 missense probably damaging 1.00
R0591:Appl2 UTSW 10 83624645 missense possibly damaging 0.94
R1695:Appl2 UTSW 10 83621582 missense probably damaging 0.99
R2218:Appl2 UTSW 10 83608737 missense possibly damaging 0.47
R4782:Appl2 UTSW 10 83600991 missense probably damaging 1.00
R4889:Appl2 UTSW 10 83641058 missense probably damaging 1.00
R5109:Appl2 UTSW 10 83601007 missense probably benign 0.06
R5460:Appl2 UTSW 10 83602832 missense probably benign 0.00
R5512:Appl2 UTSW 10 83605818 missense probably damaging 1.00
R6023:Appl2 UTSW 10 83648529 missense probably null 0.00
R6047:Appl2 UTSW 10 83612901 critical splice acceptor site probably null
R7403:Appl2 UTSW 10 83614195 missense probably benign 0.00
R7537:Appl2 UTSW 10 83617428 missense possibly damaging 0.69
X0027:Appl2 UTSW 10 83621554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTATGGCTAAAGCTAAAATGGC -3'
(R):5'- ATTCCTTGACCAGAACAGGGG -3'

Sequencing Primer
(F):5'- TGGCTAAAGCTAAAATGGCCTTCC -3'
(R):5'- CAGGGGTGGCAGGTAATACC -3'
Posted On2014-10-15