Incidental Mutation 'R2217:Timd2'
ID 241222
Institutional Source Beutler Lab
Gene Symbol Timd2
Ensembl Gene ENSMUSG00000040413
Gene Name T cell immunoglobulin and mucin domain containing 2
Synonyms TIM-2, Tim2
MMRRC Submission 040219-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R2217 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 46559787-46597888 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 46577844 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 96 (I96L)
Ref Sequence ENSEMBL: ENSMUSP00000131540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055102] [ENSMUST00000109225] [ENSMUST00000125008] [ENSMUST00000169584]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000055102
AA Change: I96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060891
Gene: ENSMUSG00000040413
AA Change: I96L

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109225
AA Change: I96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104848
Gene: ENSMUSG00000040413
AA Change: I96L

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125008
SMART Domains Protein: ENSMUSP00000123042
Gene: ENSMUSG00000040413

DomainStartEndE-ValueType
PDB:2OR7|B 19 92 6e-50 PDB
Blast:IG 22 92 4e-47 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169584
AA Change: I96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131540
Gene: ENSMUSG00000040413
AA Change: I96L

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 112,709,128 (GRCm39) K232E probably benign Het
Apba1 T C 19: 23,871,326 (GRCm39) M386T probably damaging Het
Appl2 G T 10: 83,444,601 (GRCm39) F472L possibly damaging Het
Atxn2 T C 5: 121,941,140 (GRCm39) Y56H probably damaging Het
Cacna1c T C 6: 118,647,368 (GRCm39) Y809C probably damaging Het
Canx C T 11: 50,201,694 (GRCm39) V59I probably benign Het
Catsperb T C 12: 101,560,478 (GRCm39) L823P probably damaging Het
Crb3 T C 17: 57,372,090 (GRCm39) S46P probably benign Het
Daam1 G A 12: 72,036,601 (GRCm39) R1058H probably damaging Het
Ehd1 T A 19: 6,348,502 (GRCm39) D493E probably damaging Het
Eml6 T A 11: 29,768,907 (GRCm39) Q746L probably damaging Het
Epg5 T A 18: 77,992,287 (GRCm39) M328K probably benign Het
Flt4 T A 11: 49,515,555 (GRCm39) S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm7535 A G 17: 18,131,936 (GRCm39) probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Hmcn2 A T 2: 31,240,586 (GRCm39) T494S probably benign Het
Hydin G A 8: 111,145,138 (GRCm39) V830I probably benign Het
Map3k6 T A 4: 132,973,983 (GRCm39) H487Q possibly damaging Het
Myh14 G A 7: 44,283,800 (GRCm39) P735S probably damaging Het
Nfkb2 T C 19: 46,296,163 (GRCm39) probably null Het
Nlrp4c T C 7: 6,076,113 (GRCm39) V671A probably benign Het
Nsrp1 A T 11: 76,936,587 (GRCm39) Y536* probably null Het
Or4c112 G T 2: 88,853,770 (GRCm39) H192Q probably benign Het
Pak5 A G 2: 135,958,123 (GRCm39) S322P probably damaging Het
Pank2 A G 2: 131,124,601 (GRCm39) probably null Het
Phf6 A T X: 52,031,525 (GRCm39) I272F probably damaging Het
Plxna2 T C 1: 194,480,056 (GRCm39) L1409P probably damaging Het
Polr2a A G 11: 69,633,511 (GRCm39) probably null Het
Pp2d1 C A 17: 53,822,482 (GRCm39) V195L probably benign Het
Psma1 C T 7: 113,864,173 (GRCm39) E227K unknown Het
Ptger1 C T 8: 84,395,357 (GRCm39) T278I probably benign Het
Slc20a2 C A 8: 23,050,532 (GRCm39) S250R probably benign Het
Slc27a2 A G 2: 126,409,672 (GRCm39) T285A probably damaging Het
Slc47a2 T C 11: 61,204,497 (GRCm39) T285A probably benign Het
Slf1 T A 13: 77,194,825 (GRCm39) probably null Het
Tiam2 A G 17: 3,465,389 (GRCm39) T373A probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Tmem64 T C 4: 15,266,658 (GRCm39) I236T possibly damaging Het
Trpm2 T A 10: 77,777,016 (GRCm39) D427V probably damaging Het
Vax2 A T 6: 83,714,871 (GRCm39) Y262F probably damaging Het
Virma T C 4: 11,544,924 (GRCm39) S1628P probably damaging Het
Zan C A 5: 137,408,568 (GRCm39) probably benign Het
Zbtb22 T G 17: 34,136,939 (GRCm39) D361E probably damaging Het
Zfp27 A G 7: 29,595,536 (GRCm39) L143P possibly damaging Het
Other mutations in Timd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Timd2 APN 11 46,567,170 (GRCm39) missense probably benign 0.15
IGL01289:Timd2 APN 11 46,570,499 (GRCm39) missense probably benign 0.00
IGL02066:Timd2 APN 11 46,569,050 (GRCm39) missense probably damaging 0.98
IGL02439:Timd2 APN 11 46,569,063 (GRCm39) splice site probably benign
R2218:Timd2 UTSW 11 46,577,844 (GRCm39) missense probably damaging 1.00
R2240:Timd2 UTSW 11 46,569,043 (GRCm39) missense probably benign 0.01
R3621:Timd2 UTSW 11 46,569,040 (GRCm39) missense probably benign 0.00
R3876:Timd2 UTSW 11 46,561,847 (GRCm39) critical splice acceptor site probably null
R4173:Timd2 UTSW 11 46,561,787 (GRCm39) missense probably benign 0.00
R4793:Timd2 UTSW 11 46,578,008 (GRCm39) missense probably damaging 1.00
R4799:Timd2 UTSW 11 46,568,094 (GRCm39) nonsense probably null
R4963:Timd2 UTSW 11 46,573,617 (GRCm39) missense possibly damaging 0.66
R5314:Timd2 UTSW 11 46,568,087 (GRCm39) missense probably benign 0.09
R5798:Timd2 UTSW 11 46,568,064 (GRCm39) missense probably benign 0.06
R6074:Timd2 UTSW 11 46,577,999 (GRCm39) missense possibly damaging 0.88
R6090:Timd2 UTSW 11 46,578,063 (GRCm39) missense probably benign 0.11
R6694:Timd2 UTSW 11 46,561,779 (GRCm39) nonsense probably null
R7817:Timd2 UTSW 11 46,561,781 (GRCm39) missense probably benign 0.00
R8379:Timd2 UTSW 11 46,568,027 (GRCm39) splice site probably null
R9321:Timd2 UTSW 11 46,577,916 (GRCm39) missense probably benign 0.00
R9483:Timd2 UTSW 11 46,577,889 (GRCm39) missense probably damaging 1.00
R9763:Timd2 UTSW 11 46,573,540 (GRCm39) missense probably benign 0.01
Z1177:Timd2 UTSW 11 46,570,506 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAACGGGTGTTTTAATGTCCTCAG -3'
(R):5'- GTCTCATACAGCAGTGCAGG -3'

Sequencing Primer
(F):5'- GTCCTCAGGTGTAATTACAGACTAG -3'
(R):5'- ACACTTCCATGTATTTATTCGACAC -3'
Posted On 2014-10-15