Incidental Mutation 'R2217:Canx'
ID241224
Institutional Source Beutler Lab
Gene Symbol Canx
Ensembl Gene ENSMUSG00000020368
Gene Namecalnexin
Synonyms1110069N15Rik, CNX
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50293961-50325673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50310867 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 59 (V59I)
Ref Sequence ENSEMBL: ENSMUSP00000137440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]
Predicted Effect probably benign
Transcript: ENSMUST00000020637
AA Change: V59I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: V59I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 72 441 1.7e-170 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179865
AA Change: V59I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: V59I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Calreticulin 70 441 4.7e-166 PFAM
transmembrane domain 484 506 N/A INTRINSIC
coiled coil region 525 560 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Canx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Canx APN 11 50300996 missense possibly damaging 0.61
IGL03089:Canx APN 11 50304482 missense possibly damaging 0.85
R1428:Canx UTSW 11 50308394 splice site probably benign
R1876:Canx UTSW 11 50304359 missense probably damaging 1.00
R2057:Canx UTSW 11 50304425 missense probably damaging 0.97
R2058:Canx UTSW 11 50304425 missense probably damaging 0.97
R2088:Canx UTSW 11 50310390 missense possibly damaging 0.89
R2126:Canx UTSW 11 50304358 missense probably damaging 1.00
R2218:Canx UTSW 11 50310867 missense probably benign 0.24
R2386:Canx UTSW 11 50297106 missense probably benign
R3716:Canx UTSW 11 50304474 missense probably benign 0.14
R3957:Canx UTSW 11 50308383 missense probably damaging 1.00
R4019:Canx UTSW 11 50299245 missense probably damaging 1.00
R4402:Canx UTSW 11 50304438 missense probably benign 0.13
R4825:Canx UTSW 11 50308809 missense probably benign 0.42
R5252:Canx UTSW 11 50308794 missense probably damaging 1.00
R5385:Canx UTSW 11 50301812 missense probably damaging 1.00
R5797:Canx UTSW 11 50301017 missense probably benign 0.00
R5820:Canx UTSW 11 50308383 missense probably damaging 1.00
R6052:Canx UTSW 11 50297119 missense possibly damaging 0.49
R7259:Canx UTSW 11 50301816 missense probably damaging 1.00
R7603:Canx UTSW 11 50311628 missense probably benign
R7715:Canx UTSW 11 50310804 missense probably benign 0.13
R7735:Canx UTSW 11 50301039 missense probably damaging 0.97
R8063:Canx UTSW 11 50308346 nonsense probably null
R8069:Canx UTSW 11 50311704 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTTCAGCCCCAATACTGC -3'
(R):5'- CATGTGGATTGAATTTAAGGGCAGC -3'

Sequencing Primer
(F):5'- TACTGCTTAAAAAGGGTCCAGTGC -3'
(R):5'- GTGACAATTGAAACCAAATCCTGAG -3'
Posted On2014-10-15