Mutagenetix > Incidental Mutation

Incidental Mutation 'R0165:Il3ra'

24123

Institutional Source

Beutler Lab

Gene Symbol

Il3ra

Ensembl Gene

ENSMUSG00000068758

Gene Name

interleukin 3 receptor, alpha chain

Synonyms

IL-3 receptor alpha chain, CD123, SUT-1

MMRRC Submission

038441-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R0165 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

14346275-14356011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14350967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 283 (N283K)

Ref Sequence

ENSEMBL: ENSMUSP00000153358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090591] [ENSMUST00000223589] [ENSMUST00000224163] [ENSMUST00000224877] [ENSMUST00000225775]

AlphaFold

P26952

Predicted Effect

probably benign
Transcript: ENSMUST00000090591
AA Change: N283K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000088079
Gene: ENSMUSG00000068758
AA Change: N283K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:IL6Ra-bind	119	233	6.1e-33	PFAM
transmembrane domain	333	355	N/A	INTRINSIC
low complexity region	359	374	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223589

Predicted Effect

probably benign
Transcript: ENSMUST00000224163
AA Change: N283K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224415

Predicted Effect

probably benign
Transcript: ENSMUST00000224877
AA Change: N190K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224991

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225560

Predicted Effect

probably benign
Transcript: ENSMUST00000225775

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.2%
20x: 91.4%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
PHENOTYPE: A number of distantly related inbred mouse strains carrying an identical spontaneous deletion at the branch point in intron 7 exhibit a reduced capacity of bone marrow cells to form colonies in response to interleukin-3 in CFU-GM assays. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,216,382	V1413M	probably damaging	Het
2700049A03Rik	T	C	12: 71,167,150	I717T	possibly damaging	Het
3632451O06Rik	A	G	14: 49,773,786	S155P	probably benign	Het
6430571L13Rik	A	G	9: 107,346,184		probably benign	Het
Abca15	T	A	7: 120,350,903		probably benign	Het
Abca6	A	G	11: 110,219,604	V573A	possibly damaging	Het
Adgrl2	A	G	3: 148,852,863		probably benign	Het
Agap3	A	G	5: 24,479,745	T544A	probably damaging	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Akr1c20	T	C	13: 4,523,296	T7A	probably benign	Het
Ankrd26	A	G	6: 118,540,484	S459P	probably benign	Het
Ascc3	T	A	10: 50,842,127		probably null	Het
Brd1	T	C	15: 88,729,777	N305S	probably damaging	Het
Catip	T	A	1: 74,368,469	L320Q	possibly damaging	Het
Cttnbp2	G	A	6: 18,435,410	Q150*	probably null	Het
Cyp2d22	T	G	15: 82,373,280	N228T	probably benign	Het
Dapk1	T	C	13: 60,761,593	V1340A	probably benign	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Ddhd1	G	A	14: 45,595,592	T849M	probably damaging	Het
Dnah6	A	G	6: 73,021,323	S3987P	probably benign	Het
Dst	C	A	1: 34,154,646		probably benign	Het
Epha2	T	C	4: 141,321,892		probably null	Het
Ern2	T	C	7: 122,179,779	T281A	probably benign	Het
Extl1	A	G	4: 134,357,703	F652S	probably damaging	Het
Gckr	A	G	5: 31,326,948	S541G	possibly damaging	Het
Gdap1l1	A	G	2: 163,451,499		probably null	Het
Gm7535	T	C	17: 17,911,175		probably benign	Het
Gmps	T	A	3: 63,993,954	I398N	probably damaging	Het
Igf2r	A	G	17: 12,698,527	V1556A	probably benign	Het
Ist1	A	G	8: 109,675,366		probably benign	Het
Lama3	A	T	18: 12,524,810	I1934F	probably damaging	Het
Lars	A	T	18: 42,202,697	M1118K	possibly damaging	Het
Lpin2	C	T	17: 71,246,519	S846L	probably damaging	Het
Lrrc4b	C	A	7: 44,462,315	T537K	probably damaging	Het
Ltn1	G	A	16: 87,405,519		probably benign	Het
Meiob	A	G	17: 24,835,161	T401A	probably benign	Het
Mettl21e	G	A	1: 44,211,123	T41M	probably damaging	Het
Miga1	C	T	3: 152,290,843	E323K	probably damaging	Het
Ndufs1	A	T	1: 63,159,748		probably null	Het
Olfr486	T	C	7: 108,172,675	D23G	probably benign	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Parp6	T	C	9: 59,632,925	Y274H	probably damaging	Het
Prom2	A	T	2: 127,539,514		probably benign	Het
Prune2	T	A	19: 17,122,610	M1826K	probably benign	Het
Qk	T	A	17: 10,238,963	D159V	probably damaging	Het
Rab12	A	T	17: 66,500,317	I139N	probably damaging	Het
Rab25	T	A	3: 88,548,055	E7D	probably benign	Het
Rala	A	T	13: 17,888,589	V139E	probably benign	Het
Ralgapa2	A	G	2: 146,388,487		probably benign	Het
Rbl2	T	A	8: 91,074,176	Y89N	probably damaging	Het
Rho	A	T	6: 115,932,227	I75F	probably damaging	Het
Slc38a4	C	A	15: 97,008,949	A303S	probably benign	Het
Slc6a15	A	G	10: 103,409,809	D551G	probably null	Het
Smyd3	T	C	1: 179,043,872	N314S	probably benign	Het
Speer4f1	T	A	5: 17,479,514	L180*	probably null	Het
Stat6	T	C	10: 127,657,227	V576A	probably damaging	Het
Strn	T	C	17: 78,677,374	D127G	possibly damaging	Het
Syne1	T	C	10: 5,033,096	R8610G	probably benign	Het
Tbc1d7	A	C	13: 43,153,202		probably null	Het
Tcf3	C	T	10: 80,412,997	R548Q	probably damaging	Het
Tlr9	C	A	9: 106,226,087	A859D	probably benign	Het
Tmem106c	T	A	15: 97,968,139		probably benign	Het
Tmprss11c	A	T	5: 86,231,927		probably benign	Het
Tnfsf18	A	G	1: 161,494,731	R7G	probably benign	Het
Tnrc6b	T	A	15: 80,858,670		probably null	Het
Trpm7	A	T	2: 126,797,513	F1684I	probably damaging	Het
Ttbk1	C	A	17: 46,478,938	R133L	possibly damaging	Het
Ttn	A	G	2: 76,721,342	S22962P	probably damaging	Het
Ube2q1	T	A	3: 89,776,153	L135Q	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vwce	T	C	19: 10,659,973		probably benign	Het
Wdhd1	A	G	14: 47,267,068	S350P	probably benign	Het
Zbtb21	A	G	16: 97,951,404	S560P	probably damaging	Het

Other mutations in Il3ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02454:Il3ra	APN	14	14351113	missense	probably benign	0.36
IGL02547:Il3ra	APN	14	14351970	missense	probably benign	0.01
IGL02550:Il3ra	APN	14	14348055	missense	probably benign	0.03
IGL02632:Il3ra	APN	14	14350807	critical splice donor site	probably null
IGL02737:Il3ra	APN	14	14350760	missense	probably benign	0.02
R0597:Il3ra	UTSW	14	14351166	critical splice donor site	probably null
R1109:Il3ra	UTSW	14	14349317	missense	probably damaging	1.00
R2211:Il3ra	UTSW	14	14355029	missense	probably benign	0.03
R2409:Il3ra	UTSW	14	14349377	splice site	probably null
R4258:Il3ra	UTSW	14	14347961	missense	probably damaging	1.00
R4896:Il3ra	UTSW	14	14355381	missense	probably benign	0.07
R4994:Il3ra	UTSW	14	14351080	missense	probably benign	0.19
R5004:Il3ra	UTSW	14	14355381	missense	probably benign	0.07
R5935:Il3ra	UTSW	14	14350799	missense	probably damaging	0.99
R6274:Il3ra	UTSW	14	14350180	missense	probably benign	0.19
R6350:Il3ra	UTSW	14	14348903	missense	probably benign	0.07
R6403:Il3ra	UTSW	14	14347137	missense	probably damaging	0.98
R6845:Il3ra	UTSW	14	14346517	splice site	probably null
R7417:Il3ra	UTSW	14	14349345	missense	probably benign	0.08
R7432:Il3ra	UTSW	14	14350691	missense	possibly damaging	0.64
R7450:Il3ra	UTSW	14	14351090	missense	probably benign	0.25
R7917:Il3ra	UTSW	14	14350773	missense	possibly damaging	0.66
R8048:Il3ra	UTSW	14	14348903	missense	probably benign	0.07
Z1088:Il3ra	UTSW	14	14351129	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACTATGCACTAACATGCGTCGCC -3'
(R):5'- TGAGCTTCCGAGGGTAAACCTCTG -3'

Sequencing Primer
(F):5'- AACATGCGTCGCCCTACTG -3'
(R):5'- AGGGTAAACCTCTGACCTCG -3'

Posted On

2013-04-16