Incidental Mutation 'R2217:Zbtb22'
List |< first << previous [record 45 of 46] next >> last >|
ID241234
Institutional Source Beutler Lab
Gene Symbol Zbtb22
Ensembl Gene ENSMUSG00000051390
Gene Namezinc finger and BTB domain containing 22
Synonyms1110008J20Rik, Bing1, Zfp297
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33915904-33919324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33917965 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 361 (D361E)
Ref Sequence ENSEMBL: ENSMUSP00000057466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053429
AA Change: D361E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390
AA Change: D361E

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079421
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170075
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172489
SMART Domains Protein: ENSMUSP00000133332
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
IG 18 142 3.45e0 SMART
SCOP:d2fbjh2 143 189 2e-3 SMART
Blast:IG_like 152 206 6e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172619
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably benign
Transcript: ENSMUST00000174146
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174541
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189156
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Zbtb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Zbtb22 APN 17 33917013 missense probably damaging 1.00
PIT4515001:Zbtb22 UTSW 17 33918698 missense probably benign 0.00
R0539:Zbtb22 UTSW 17 33918144 missense possibly damaging 0.93
R0972:Zbtb22 UTSW 17 33917352 missense possibly damaging 0.57
R2218:Zbtb22 UTSW 17 33917965 missense probably damaging 1.00
R2520:Zbtb22 UTSW 17 33916982 missense probably damaging 1.00
R3806:Zbtb22 UTSW 17 33916946 unclassified probably benign
R4086:Zbtb22 UTSW 17 33918168 missense probably damaging 0.99
R5004:Zbtb22 UTSW 17 33917243 missense probably benign 0.29
R5141:Zbtb22 UTSW 17 33918636 missense possibly damaging 0.81
R5158:Zbtb22 UTSW 17 33918449 missense probably damaging 0.97
R5677:Zbtb22 UTSW 17 33917735 missense probably benign
R5804:Zbtb22 UTSW 17 33918619 frame shift probably null
R6358:Zbtb22 UTSW 17 33918737 missense probably damaging 1.00
R6495:Zbtb22 UTSW 17 33917250 missense probably damaging 1.00
R6975:Zbtb22 UTSW 17 33917964 missense probably damaging 1.00
R7561:Zbtb22 UTSW 17 33917978 missense probably benign 0.01
R7658:Zbtb22 UTSW 17 33918497 missense probably damaging 0.99
R7664:Zbtb22 UTSW 17 33918579 missense probably benign 0.01
R8146:Zbtb22 UTSW 17 33916982 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAATTGCCCTGCACCAG -3'
(R):5'- ACCAGAGCCACTTGGTATGC -3'

Sequencing Primer
(F):5'- GCCTCCCTGGTCCACCAAG -3'
(R):5'- TTGCCCGGCACATCCAATG -3'
Posted On2014-10-15