Incidental Mutation 'R2217:Pp2d1'
List |< first << previous [record 30 of 46] next >> last >|
ID241235
Institutional Source Beutler Lab
Gene Symbol Pp2d1
Ensembl Gene ENSMUSG00000044957
Gene Nameprotein phosphatase 2C-like domain containing 1
Synonyms
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location53507460-53539451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53515454 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 195 (V195L)
Ref Sequence ENSEMBL: ENSMUSP00000056682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056198]
Predicted Effect probably benign
Transcript: ENSMUST00000056198
AA Change: V195L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000056682
Gene: ENSMUSG00000044957
AA Change: V195L

DomainStartEndE-ValueType
PP2Cc 173 609 4.04e-18 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Pp2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Pp2d1 APN 17 53515639 missense probably benign 0.00
IGL01939:Pp2d1 APN 17 53515139 missense probably damaging 1.00
IGL02031:Pp2d1 APN 17 53508440 missense probably damaging 1.00
IGL02039:Pp2d1 APN 17 53515994 nonsense probably null
IGL02108:Pp2d1 APN 17 53515405 missense probably damaging 1.00
IGL02121:Pp2d1 APN 17 53507921 missense probably damaging 1.00
IGL03034:Pp2d1 APN 17 53508053 missense possibly damaging 0.88
R0483:Pp2d1 UTSW 17 53507971 missense probably benign 0.29
R0562:Pp2d1 UTSW 17 53539168 splice site probably benign
R1416:Pp2d1 UTSW 17 53515807 missense probably benign 0.07
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1479:Pp2d1 UTSW 17 53507855 missense probably benign 0.05
R1659:Pp2d1 UTSW 17 53515378 missense possibly damaging 0.50
R1711:Pp2d1 UTSW 17 53515310 missense possibly damaging 0.47
R2214:Pp2d1 UTSW 17 53515396 missense probably benign 0.01
R2218:Pp2d1 UTSW 17 53515454 missense probably benign 0.02
R4463:Pp2d1 UTSW 17 53515858 missense probably benign
R4644:Pp2d1 UTSW 17 53515987 missense probably benign 0.00
R4901:Pp2d1 UTSW 17 53515009 missense probably benign 0.20
R5164:Pp2d1 UTSW 17 53508070 missense probably benign 0.11
R5169:Pp2d1 UTSW 17 53507902 missense possibly damaging 0.78
R5186:Pp2d1 UTSW 17 53508140 missense probably benign
R5223:Pp2d1 UTSW 17 53507845 missense probably benign 0.12
R6550:Pp2d1 UTSW 17 53515576 missense probably damaging 0.98
R6918:Pp2d1 UTSW 17 53515459 missense probably damaging 0.99
R7263:Pp2d1 UTSW 17 53515330 missense probably benign 0.00
R7623:Pp2d1 UTSW 17 53515879 missense probably benign 0.00
R7712:Pp2d1 UTSW 17 53508290 missense possibly damaging 0.63
R8062:Pp2d1 UTSW 17 53515770 missense probably benign 0.01
R8165:Pp2d1 UTSW 17 53515229 missense probably damaging 1.00
X0019:Pp2d1 UTSW 17 53515547 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GAGTTGCTTCTGCTCAGCTG -3'
(R):5'- CTGGTCAGTCTTCATAGAGAGTG -3'

Sequencing Primer
(F):5'- CAGCTGTCATTTGGTAGGAAGGATC -3'
(R):5'- TGTGAACTACGCATTTGAGTTTC -3'
Posted On2014-10-15