Mutagenetix > Incidental Mutations

Incidental Mutation 'R2217:Apba1'

241240

Institutional Source

Beutler Lab

Gene Symbol

Apba1

Ensembl Gene

ENSMUSG00000024897

Gene Name

amyloid beta (A4) precursor protein binding, family A, member 1

Synonyms

6430513E09Rik, Lin-10, X11, Mint, Mint1, X11alpha

MMRRC Submission

040219-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2217 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23758876-23949597 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23893962 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 386 (M386T)

Ref Sequence

ENSEMBL: ENSMUSP00000025830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025830]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025830
AA Change: M386T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897
AA Change: M386T

Domain	Start	End	E-Value	Type
low complexity region	40	47	N/A	INTRINSIC
low complexity region	59	74	N/A	INTRINSIC
low complexity region	129	149	N/A	INTRINSIC
low complexity region	404	421	N/A	INTRINSIC
PTB	461	626	9.49e-33	SMART
PDZ	670	748	3.09e-15	SMART
PDZ	762	828	2.53e-11	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat1	T	C	8: 111,982,496	K232E	probably benign	Het
Appl2	G	T	10: 83,608,737	F472L	possibly damaging	Het
Atxn2	T	C	5: 121,803,077	Y56H	probably damaging	Het
Cacna1c	T	C	6: 118,670,407	Y809C	probably damaging	Het
Canx	C	T	11: 50,310,867	V59I	probably benign	Het
Catsperb	T	C	12: 101,594,219	L823P	probably damaging	Het
Crb3	T	C	17: 57,065,090	S46P	probably benign	Het
Daam1	G	A	12: 71,989,827	R1058H	probably damaging	Het
Ehd1	T	A	19: 6,298,472	D493E	probably damaging	Het
Eml6	T	A	11: 29,818,907	Q746L	probably damaging	Het
Epg5	T	A	18: 77,949,072	M328K	probably benign	Het
Flt4	T	A	11: 49,624,728	S48T	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm7535	A	G	17: 17,911,674		probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Hmcn2	A	T	2: 31,350,574	T494S	probably benign	Het
Hydin	G	A	8: 110,418,506	V830I	probably benign	Het
Map3k6	T	A	4: 133,246,672	H487Q	possibly damaging	Het
Myh14	G	A	7: 44,634,376	P735S	probably damaging	Het
Nfkb2	T	C	19: 46,307,724		probably null	Het
Nlrp4c	T	C	7: 6,073,114	V671A	probably benign	Het
Nsrp1	A	T	11: 77,045,761	Y536*	probably null	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Pak7	A	G	2: 136,116,203	S322P	probably damaging	Het
Pank2	A	G	2: 131,282,681		probably null	Het
Phf6	A	T	X: 52,942,648	I272F	probably damaging	Het
Plxna2	T	C	1: 194,797,748	L1409P	probably damaging	Het
Polr2a	A	G	11: 69,742,685		probably null	Het
Pp2d1	C	A	17: 53,515,454	V195L	probably benign	Het
Psma1	C	T	7: 114,264,938	E227K	unknown	Het
Ptger1	C	T	8: 83,668,728	T278I	probably benign	Het
Slc20a2	C	A	8: 22,560,516	S250R	probably benign	Het
Slc27a2	A	G	2: 126,567,752	T285A	probably damaging	Het
Slc47a2	T	C	11: 61,313,671	T285A	probably benign	Het
Slf1	T	A	13: 77,046,706		probably null	Het
Tiam2	A	G	17: 3,415,114	T373A	probably benign	Het
Timd2	T	A	11: 46,687,017	I96L	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tmem64	T	C	4: 15,266,658	I236T	possibly damaging	Het
Trpm2	T	A	10: 77,941,182	D427V	probably damaging	Het
Vax2	A	T	6: 83,737,889	Y262F	probably damaging	Het
Virma	T	C	4: 11,544,924	S1628P	probably damaging	Het
Zan	C	A	5: 137,410,306		probably benign	Het
Zbtb22	T	G	17: 33,917,965	D361E	probably damaging	Het
Zfp27	A	G	7: 29,896,111	L143P	possibly damaging	Het

Other mutations in Apba1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Apba1	APN	19	23917586	missense	possibly damaging	0.95
IGL01991:Apba1	APN	19	23937472	missense	possibly damaging	0.80
IGL02048:Apba1	APN	19	23937636	splice site	probably null
IGL02522:Apba1	APN	19	23912445	splice site	probably benign
IGL02728:Apba1	APN	19	23944905	missense	possibly damaging	0.93
IGL02942:Apba1	APN	19	23944971	missense	possibly damaging	0.78
IGL03349:Apba1	APN	19	23917575	missense	probably benign	0.02
IGL03410:Apba1	APN	19	23937581	missense	possibly damaging	0.67
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0052:Apba1	UTSW	19	23915951	missense	possibly damaging	0.90
R0084:Apba1	UTSW	19	23912497	missense	possibly damaging	0.68
R0379:Apba1	UTSW	19	23934830	missense	probably damaging	1.00
R0423:Apba1	UTSW	19	23944998	missense	probably damaging	1.00
R1132:Apba1	UTSW	19	23917553	missense	possibly damaging	0.83
R1291:Apba1	UTSW	19	23917672	missense	probably damaging	0.97
R1681:Apba1	UTSW	19	23936561	missense	probably damaging	1.00
R1714:Apba1	UTSW	19	23944952	missense	possibly damaging	0.67
R1756:Apba1	UTSW	19	23893692	missense	possibly damaging	0.83
R1866:Apba1	UTSW	19	23892831	missense	probably benign	0.22
R2076:Apba1	UTSW	19	23893223	nonsense	probably null
R3907:Apba1	UTSW	19	23937506	missense	probably damaging	0.96
R4095:Apba1	UTSW	19	23944024	missense	probably benign	0.00
R4529:Apba1	UTSW	19	23936535	missense	probably damaging	1.00
R4557:Apba1	UTSW	19	23917592	missense	probably damaging	1.00
R4972:Apba1	UTSW	19	23912536	missense	probably benign	0.24
R5521:Apba1	UTSW	19	23893593	missense	probably damaging	1.00
R6539:Apba1	UTSW	19	23936560	missense	probably damaging	1.00
R7032:Apba1	UTSW	19	23912461	missense	probably benign	0.20
R7035:Apba1	UTSW	19	23917567	missense	possibly damaging	0.88
R7495:Apba1	UTSW	19	23936599	critical splice donor site	probably null
Z1176:Apba1	UTSW	19	23944115	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGCATGAGTTCGCAGAGC -3'
(R):5'- TGGATGAAACTACCACGGGG -3'

Sequencing Primer
(F):5'- ATGAGTTCGCAGAGCCTCGAC -3'
(R):5'- AACTACCACGGGGAGGTGC -3'

Posted On

2014-10-15