Mutagenetix > Incidental Mutation

Incidental Mutation 'R2217:Nfkb2'

241241

Institutional Source

Beutler Lab

Gene Symbol

Nfkb2

Ensembl Gene

ENSMUSG00000025225

Gene Name

nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100

Synonyms

NF kappaB2, p52

MMRRC Submission

040219-MU

Accession Numbers

Genbank: NM_019408; MGI: 1099800

Is this an essential gene?

Possibly essential (E-score: 0.636) question?

Stock #

R2217 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46304737-46312090 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 46307724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]

AlphaFold

Q9WTK5

Predicted Effect

probably benign
Transcript: ENSMUST00000041391

SMART Domains

Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

Domain	Start	End	E-Value	Type
low complexity region	48	63	N/A	INTRINSIC
low complexity region	79	99	N/A	INTRINSIC
low complexity region	329	368	N/A	INTRINSIC
low complexity region	419	431	N/A	INTRINSIC
low complexity region	445	466	N/A	INTRINSIC
Sec7	519	708	5.08e-75	SMART
low complexity region	714	724	N/A	INTRINSIC
low complexity region	736	744	N/A	INTRINSIC
PH	757	871	1.87e-13	SMART
Blast:Sec7	900	952	1e-6	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000073116

SMART Domains

Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225

Domain	Start	End	E-Value	Type
Pfam:RHD_DNA_bind	40	220	1.3e-67	PFAM
IPT	227	326	3.48e-27	SMART
low complexity region	351	382	N/A	INTRINSIC
low complexity region	391	409	N/A	INTRINSIC
ANK	487	522	5.58e1	SMART
ANK	526	555	9.78e-4	SMART
ANK	559	591	3.74e0	SMART
ANK	599	628	3.36e-2	SMART
ANK	633	663	1.3e1	SMART
ANK	667	696	4.26e-4	SMART
low complexity region	707	721	N/A	INTRINSIC
ANK	729	758	2.35e3	SMART
DEATH	764	851	5.52e-16	SMART
low complexity region	879	894	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000096029

SMART Domains

Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

Domain	Start	End	E-Value	Type
low complexity region	48	63	N/A	INTRINSIC
low complexity region	79	99	N/A	INTRINSIC
low complexity region	329	368	N/A	INTRINSIC
low complexity region	419	431	N/A	INTRINSIC
low complexity region	445	466	N/A	INTRINSIC
Sec7	520	709	5.08e-75	SMART
low complexity region	715	725	N/A	INTRINSIC
low complexity region	737	745	N/A	INTRINSIC
PH	758	872	1.87e-13	SMART
Blast:Sec7	901	953	1e-6	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000111881

SMART Domains

Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225

Domain	Start	End	E-Value	Type
Pfam:RHD	40	220	1.3e-67	PFAM
IPT	227	326	3.48e-27	SMART
low complexity region	351	382	N/A	INTRINSIC
low complexity region	391	409	N/A	INTRINSIC
ANK	487	522	5.58e1	SMART
ANK	526	555	9.78e-4	SMART
ANK	559	591	3.74e0	SMART
ANK	599	628	3.36e-2	SMART
ANK	633	663	1.3e1	SMART
ANK	667	696	4.26e-4	SMART
low complexity region	707	721	N/A	INTRINSIC
ANK	729	758	2.35e3	SMART
DEATH	764	851	5.52e-16	SMART
low complexity region	879	894	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224556

Predicted Effect

probably benign
Transcript: ENSMUST00000225323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225748

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Chemically induced(2)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat1	T	C	8: 111,982,496	K232E	probably benign	Het
Apba1	T	C	19: 23,893,962	M386T	probably damaging	Het
Appl2	G	T	10: 83,608,737	F472L	possibly damaging	Het
Atxn2	T	C	5: 121,803,077	Y56H	probably damaging	Het
Cacna1c	T	C	6: 118,670,407	Y809C	probably damaging	Het
Canx	C	T	11: 50,310,867	V59I	probably benign	Het
Catsperb	T	C	12: 101,594,219	L823P	probably damaging	Het
Crb3	T	C	17: 57,065,090	S46P	probably benign	Het
Daam1	G	A	12: 71,989,827	R1058H	probably damaging	Het
Ehd1	T	A	19: 6,298,472	D493E	probably damaging	Het
Eml6	T	A	11: 29,818,907	Q746L	probably damaging	Het
Epg5	T	A	18: 77,949,072	M328K	probably benign	Het
Flt4	T	A	11: 49,624,728	S48T	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm7535	A	G	17: 17,911,674		probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Hmcn2	A	T	2: 31,350,574	T494S	probably benign	Het
Hydin	G	A	8: 110,418,506	V830I	probably benign	Het
Map3k6	T	A	4: 133,246,672	H487Q	possibly damaging	Het
Myh14	G	A	7: 44,634,376	P735S	probably damaging	Het
Nlrp4c	T	C	7: 6,073,114	V671A	probably benign	Het
Nsrp1	A	T	11: 77,045,761	Y536*	probably null	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Pak7	A	G	2: 136,116,203	S322P	probably damaging	Het
Pank2	A	G	2: 131,282,681		probably null	Het
Phf6	A	T	X: 52,942,648	I272F	probably damaging	Het
Plxna2	T	C	1: 194,797,748	L1409P	probably damaging	Het
Polr2a	A	G	11: 69,742,685		probably null	Het
Pp2d1	C	A	17: 53,515,454	V195L	probably benign	Het
Psma1	C	T	7: 114,264,938	E227K	unknown	Het
Ptger1	C	T	8: 83,668,728	T278I	probably benign	Het
Slc20a2	C	A	8: 22,560,516	S250R	probably benign	Het
Slc27a2	A	G	2: 126,567,752	T285A	probably damaging	Het
Slc47a2	T	C	11: 61,313,671	T285A	probably benign	Het
Slf1	T	A	13: 77,046,706		probably null	Het
Tiam2	A	G	17: 3,415,114	T373A	probably benign	Het
Timd2	T	A	11: 46,687,017	I96L	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tmem64	T	C	4: 15,266,658	I236T	possibly damaging	Het
Trpm2	T	A	10: 77,941,182	D427V	probably damaging	Het
Vax2	A	T	6: 83,737,889	Y262F	probably damaging	Het
Virma	T	C	4: 11,544,924	S1628P	probably damaging	Het
Zan	C	A	5: 137,410,306		probably benign	Het
Zbtb22	T	G	17: 33,917,965	D361E	probably damaging	Het
Zfp27	A	G	7: 29,896,111	L143P	possibly damaging	Het

Other mutations in Nfkb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
xander	APN	19		splice acceptor site
IGL01466:Nfkb2	APN	19	46308016	missense	probably damaging	0.96
IGL01791:Nfkb2	APN	19	46309839	unclassified	probably benign
IGL01966:Nfkb2	APN	19	46309690	missense	probably benign	0.04
IGL03296:Nfkb2	APN	19	46309928	missense	probably damaging	1.00
Dolores	UTSW	19	46308223	missense	possibly damaging	0.86
Gawk	UTSW	19	46306865	missense	probably damaging	1.00
haze	UTSW	19	46307434	missense	possibly damaging	0.93
humbert	UTSW	19	46307441	missense	possibly damaging	0.86
lolita	UTSW	19	46307720	critical splice donor site	probably null
Nabukov	UTSW	19	46308439	missense	probably damaging	0.99
pale_fire	UTSW	19	46311626	missense	possibly damaging	0.96
Quilty	UTSW	19	46308643	missense	possibly damaging	0.64
R0270:Nfkb2	UTSW	19	46311626	missense	possibly damaging	0.96
R0561:Nfkb2	UTSW	19	46309862	missense	possibly damaging	0.93
R1944:Nfkb2	UTSW	19	46308052	missense	probably damaging	1.00
R2878:Nfkb2	UTSW	19	46307441	missense	possibly damaging	0.86
R4493:Nfkb2	UTSW	19	46308439	missense	probably damaging	0.99
R4494:Nfkb2	UTSW	19	46308439	missense	probably damaging	0.99
R4495:Nfkb2	UTSW	19	46308439	missense	probably damaging	0.99
R4731:Nfkb2	UTSW	19	46308964	missense	possibly damaging	0.74
R4752:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R4753:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R4777:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R4780:Nfkb2	UTSW	19	46309922	missense	probably damaging	1.00
R4820:Nfkb2	UTSW	19	46308054	missense	probably damaging	0.99
R4837:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R4839:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R5514:Nfkb2	UTSW	19	46311408	missense	probably damaging	1.00
R5519:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R5549:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R5615:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R5616:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
R5709:Nfkb2	UTSW	19	46310521	missense	probably damaging	1.00
R6053:Nfkb2	UTSW	19	46311812	missense	probably damaging	1.00
R6794:Nfkb2	UTSW	19	46307720	critical splice donor site	probably null
R7539:Nfkb2	UTSW	19	46308223	missense	possibly damaging	0.86
R7573:Nfkb2	UTSW	19	46308643	missense	possibly damaging	0.64
R7963:Nfkb2	UTSW	19	46309919	missense	possibly damaging	0.78
R8147:Nfkb2	UTSW	19	46307434	missense	possibly damaging	0.93
R8153:Nfkb2	UTSW	19	46308016	missense	probably damaging	0.96
R8241:Nfkb2	UTSW	19	46307615	missense	probably benign	0.01
R8992:Nfkb2	UTSW	19	46306865	missense	probably damaging	1.00
R9405:Nfkb2	UTSW	19	46308400	missense	probably damaging	1.00
R9549:Nfkb2	UTSW	19	46309672	missense	probably damaging	1.00
R9709:Nfkb2	UTSW	19	46310343	missense	probably benign	0.02
S24628:Nfkb2	UTSW	19	46307567	missense	probably benign	0.02
Z1177:Nfkb2	UTSW	19	46311590	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGTGTTCCTAGAGGAGC -3'
(R):5'- CTCGGTGGGGTCATTATCAAAC -3'

Sequencing Primer
(F):5'- CCACATTGTCCATCCAGAGG -3'
(R):5'- CGGTGGGGTCATTATCAAACTTCAG -3'

Posted On

2014-10-15