Incidental Mutation 'R2217:Phf6'
List |< first << previous [record 27 of 46] next >> last >|
ID241242
Institutional Source Beutler Lab
Gene Symbol Phf6
Ensembl Gene ENSMUSG00000025626
Gene NamePHD finger protein 6
Synonyms2700007B13Rik, 4931428F02Rik
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2217 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location52912266-52956943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52942648 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 272 (I272F)
Ref Sequence ENSEMBL: ENSMUSP00000110497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078944] [ENSMUST00000101587] [ENSMUST00000154864]
Predicted Effect probably damaging
Transcript: ENSMUST00000078944
AA Change: I272F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077971
Gene: ENSMUSG00000025626
AA Change: I272F

DomainStartEndE-ValueType
PHD 81 132 2.9e-1 SMART
low complexity region 153 170 N/A INTRINSIC
PHD 279 330 2.39e-2 SMART
low complexity region 333 343 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101587
AA Change: I272F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110497
Gene: ENSMUSG00000025626
AA Change: I272F

DomainStartEndE-ValueType
PHD 81 132 2.9e-1 SMART
low complexity region 153 170 N/A INTRINSIC
PHD 279 314 1.49e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154864
AA Change: I192F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130358
Gene: ENSMUSG00000025626
AA Change: I192F

DomainStartEndE-ValueType
PHD 1 52 2.9e-1 SMART
low complexity region 73 90 N/A INTRINSIC
PHD 199 250 2.39e-2 SMART
low complexity region 253 263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179014
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Phf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phf6 APN X 52931646 missense probably damaging 1.00
IGL00565:Phf6 APN X 52931639 missense probably damaging 1.00
R2447:Phf6 UTSW X 52953558 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGCAAAGTCTCTGGAAGATTTCG -3'
(R):5'- TCTCTGCAGTCAAGTTGTAGTTC -3'

Sequencing Primer
(F):5'- CAAAGTCTCTGGAAGATTTCGAAATG -3'
(R):5'- GTTCTTAAAGCTAGTGACCAATGACC -3'
Posted On2014-10-15