Mutagenetix > Incidental Mutation

Incidental Mutation 'R0165:Wdhd1'

24125

Institutional Source

Beutler Lab

Gene Symbol

Wdhd1

Ensembl Gene

ENSMUSG00000037572

Gene Name

WD repeat and HMG-box DNA binding protein 1

Synonyms

AND-1, D630024B06Rik

MMRRC Submission

038441-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0165 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

47240944-47276857 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47267068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 350 (S350P)

Ref Sequence

ENSEMBL: ENSMUSP00000141182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111790
AA Change: S350P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572
AA Change: S350P

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:DUF3639	525	551	2.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111791
AA Change: S350P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: S350P

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:Mcl1_mid	424	708	1.6e-103	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111792

SMART Domains

Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	316	326	N/A	INTRINSIC
Pfam:DUF3639	488	514	7.1e-13	PFAM
coiled coil region	765	797	N/A	INTRINSIC
HMG	966	1036	2.64e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122699

Predicted Effect

probably benign
Transcript: ENSMUST00000187531
AA Change: S350P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: S350P

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:DUF3639	525	551	3e-13	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228742

Meta Mutation Damage Score

0.0670

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.2%
20x: 91.4%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,216,382	V1413M	probably damaging	Het
2700049A03Rik	T	C	12: 71,167,150	I717T	possibly damaging	Het
3632451O06Rik	A	G	14: 49,773,786	S155P	probably benign	Het
6430571L13Rik	A	G	9: 107,346,184		probably benign	Het
Abca15	T	A	7: 120,350,903		probably benign	Het
Abca6	A	G	11: 110,219,604	V573A	possibly damaging	Het
Adgrl2	A	G	3: 148,852,863		probably benign	Het
Agap3	A	G	5: 24,479,745	T544A	probably damaging	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Akr1c20	T	C	13: 4,523,296	T7A	probably benign	Het
Ankrd26	A	G	6: 118,540,484	S459P	probably benign	Het
Ascc3	T	A	10: 50,842,127		probably null	Het
Brd1	T	C	15: 88,729,777	N305S	probably damaging	Het
Catip	T	A	1: 74,368,469	L320Q	possibly damaging	Het
Cttnbp2	G	A	6: 18,435,410	Q150*	probably null	Het
Cyp2d22	T	G	15: 82,373,280	N228T	probably benign	Het
Dapk1	T	C	13: 60,761,593	V1340A	probably benign	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Ddhd1	G	A	14: 45,595,592	T849M	probably damaging	Het
Dnah6	A	G	6: 73,021,323	S3987P	probably benign	Het
Dst	C	A	1: 34,154,646		probably benign	Het
Epha2	T	C	4: 141,321,892		probably null	Het
Ern2	T	C	7: 122,179,779	T281A	probably benign	Het
Extl1	A	G	4: 134,357,703	F652S	probably damaging	Het
Gckr	A	G	5: 31,326,948	S541G	possibly damaging	Het
Gdap1l1	A	G	2: 163,451,499		probably null	Het
Gm7535	T	C	17: 17,911,175		probably benign	Het
Gmps	T	A	3: 63,993,954	I398N	probably damaging	Het
Igf2r	A	G	17: 12,698,527	V1556A	probably benign	Het
Il3ra	T	A	14: 14,350,967	N283K	probably benign	Het
Ist1	A	G	8: 109,675,366		probably benign	Het
Lama3	A	T	18: 12,524,810	I1934F	probably damaging	Het
Lars	A	T	18: 42,202,697	M1118K	possibly damaging	Het
Lpin2	C	T	17: 71,246,519	S846L	probably damaging	Het
Lrrc4b	C	A	7: 44,462,315	T537K	probably damaging	Het
Ltn1	G	A	16: 87,405,519		probably benign	Het
Meiob	A	G	17: 24,835,161	T401A	probably benign	Het
Mettl21e	G	A	1: 44,211,123	T41M	probably damaging	Het
Miga1	C	T	3: 152,290,843	E323K	probably damaging	Het
Ndufs1	A	T	1: 63,159,748		probably null	Het
Olfr486	T	C	7: 108,172,675	D23G	probably benign	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Parp6	T	C	9: 59,632,925	Y274H	probably damaging	Het
Prom2	A	T	2: 127,539,514		probably benign	Het
Prune2	T	A	19: 17,122,610	M1826K	probably benign	Het
Qk	T	A	17: 10,238,963	D159V	probably damaging	Het
Rab12	A	T	17: 66,500,317	I139N	probably damaging	Het
Rab25	T	A	3: 88,548,055	E7D	probably benign	Het
Rala	A	T	13: 17,888,589	V139E	probably benign	Het
Ralgapa2	A	G	2: 146,388,487		probably benign	Het
Rbl2	T	A	8: 91,074,176	Y89N	probably damaging	Het
Rho	A	T	6: 115,932,227	I75F	probably damaging	Het
Slc38a4	C	A	15: 97,008,949	A303S	probably benign	Het
Slc6a15	A	G	10: 103,409,809	D551G	probably null	Het
Smyd3	T	C	1: 179,043,872	N314S	probably benign	Het
Speer4f1	T	A	5: 17,479,514	L180*	probably null	Het
Stat6	T	C	10: 127,657,227	V576A	probably damaging	Het
Strn	T	C	17: 78,677,374	D127G	possibly damaging	Het
Syne1	T	C	10: 5,033,096	R8610G	probably benign	Het
Tbc1d7	A	C	13: 43,153,202		probably null	Het
Tcf3	C	T	10: 80,412,997	R548Q	probably damaging	Het
Tlr9	C	A	9: 106,226,087	A859D	probably benign	Het
Tmem106c	T	A	15: 97,968,139		probably benign	Het
Tmprss11c	A	T	5: 86,231,927		probably benign	Het
Tnfsf18	A	G	1: 161,494,731	R7G	probably benign	Het
Tnrc6b	T	A	15: 80,858,670		probably null	Het
Trpm7	A	T	2: 126,797,513	F1684I	probably damaging	Het
Ttbk1	C	A	17: 46,478,938	R133L	possibly damaging	Het
Ttn	A	G	2: 76,721,342	S22962P	probably damaging	Het
Ube2q1	T	A	3: 89,776,153	L135Q	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vwce	T	C	19: 10,659,973		probably benign	Het
Zbtb21	A	G	16: 97,951,404	S560P	probably damaging	Het

Other mutations in Wdhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Wdhd1	APN	14	47250782	missense	possibly damaging	0.87
IGL01789:Wdhd1	APN	14	47274817	missense	probably benign	0.10
IGL01981:Wdhd1	APN	14	47261450	missense	probably damaging	1.00
IGL02034:Wdhd1	APN	14	47261351	missense	probably benign	0.02
IGL02932:Wdhd1	APN	14	47272134	critical splice donor site	probably null
IGL02966:Wdhd1	APN	14	47241644	missense	possibly damaging	0.93
IGL03355:Wdhd1	APN	14	47243889	missense	possibly damaging	0.78
R0414:Wdhd1	UTSW	14	47276588	missense	probably benign
R0603:Wdhd1	UTSW	14	47263586	missense	probably damaging	1.00
R1503:Wdhd1	UTSW	14	47247400	missense	probably benign	0.00
R1539:Wdhd1	UTSW	14	47245050	missense	possibly damaging	0.63
R1541:Wdhd1	UTSW	14	47268192	nonsense	probably null
R1588:Wdhd1	UTSW	14	47256236	missense	probably damaging	1.00
R1686:Wdhd1	UTSW	14	47256215	missense	probably damaging	1.00
R1916:Wdhd1	UTSW	14	47258577	missense	possibly damaging	0.89
R1952:Wdhd1	UTSW	14	47270190	missense	probably damaging	1.00
R2320:Wdhd1	UTSW	14	47274028	missense	probably benign	0.06
R2421:Wdhd1	UTSW	14	47258584	missense	probably benign	0.00
R3731:Wdhd1	UTSW	14	47247892	missense	possibly damaging	0.89
R3818:Wdhd1	UTSW	14	47243801	critical splice donor site	probably null
R3836:Wdhd1	UTSW	14	47245054	missense	probably benign	0.01
R4789:Wdhd1	UTSW	14	47268692	missense	probably benign	0.01
R4963:Wdhd1	UTSW	14	47268689	missense	possibly damaging	0.66
R4994:Wdhd1	UTSW	14	47268654	critical splice donor site	probably null
R5225:Wdhd1	UTSW	14	47250816	missense	probably benign	0.01
R5347:Wdhd1	UTSW	14	47268724	nonsense	probably null
R5377:Wdhd1	UTSW	14	47272221	missense	probably benign	0.15
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6046:Wdhd1	UTSW	14	47273210	nonsense	probably null
R6156:Wdhd1	UTSW	14	47268196	missense	probably damaging	0.99
R6289:Wdhd1	UTSW	14	47258496	missense	possibly damaging	0.95
R6298:Wdhd1	UTSW	14	47273122	missense	possibly damaging	0.67
R6345:Wdhd1	UTSW	14	47251922	missense	probably damaging	0.99
R6405:Wdhd1	UTSW	14	47243867	missense	possibly damaging	0.91
R6500:Wdhd1	UTSW	14	47250760	splice site	probably null
R6564:Wdhd1	UTSW	14	47248042	missense	probably benign
R6897:Wdhd1	UTSW	14	47248130	missense	probably damaging	1.00
R7262:Wdhd1	UTSW	14	47251973	missense	probably benign	0.08
R7444:Wdhd1	UTSW	14	47251948	nonsense	probably null
R7496:Wdhd1	UTSW	14	47274024	missense	probably benign	0.39
R7503:Wdhd1	UTSW	14	47250791	missense	probably benign	0.25
R8317:Wdhd1	UTSW	14	47263537	missense	probably damaging	1.00
R8323:Wdhd1	UTSW	14	47274795	missense	possibly damaging	0.85
R8331:Wdhd1	UTSW	14	47272245	splice site	probably null
R8338:Wdhd1	UTSW	14	47268663	missense	probably benign
R8363:Wdhd1	UTSW	14	47276532	missense	probably damaging	1.00
R8944:Wdhd1	UTSW	14	47267013	missense	probably benign
R8946:Wdhd1	UTSW	14	47245295	missense	probably benign	0.01
R9045:Wdhd1	UTSW	14	47273952	missense	probably benign	0.01
R9428:Wdhd1	UTSW	14	47251970	nonsense	probably null
R9444:Wdhd1	UTSW	14	47250867	missense	possibly damaging	0.85
R9491:Wdhd1	UTSW	14	47268159	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- gccctctcTCTAACTTTTCCATTTCCGA -3'
(R):5'- CCTGACCAGAGCACAAAGCATTTAACAT -3'

Sequencing Primer
(F):5'- TGTACCTCTAGACGCTAATTAAGCC -3'
(R):5'- tggtgggtaggcagaagg -3'

Posted On

2013-04-16