Incidental Mutation 'R2218:Atxn2'
ID 241257
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 040220-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R2218 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121941140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 56 (Y56H)
Ref Sequence ENSEMBL: ENSMUSP00000123833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000161159] [ENSMUST00000162327]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051950
AA Change: Y1078H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: Y1078H

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160093
Predicted Effect probably benign
Transcript: ENSMUST00000160462
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161064
AA Change: Y769H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: Y769H

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161159
AA Change: Y56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605
AA Change: Y56H

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161872
Predicted Effect probably damaging
Transcript: ENSMUST00000162327
AA Change: Y472H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: Y472H

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abitram G T 4: 56,802,693 (GRCm39) V26L probably damaging Het
Acap3 A G 4: 155,988,319 (GRCm39) probably null Het
Appl2 G T 10: 83,444,601 (GRCm39) F472L possibly damaging Het
Atp13a5 A T 16: 29,140,464 (GRCm39) V319D probably damaging Het
Brinp1 A G 4: 68,680,952 (GRCm39) L526P probably damaging Het
Cacna1d C T 14: 29,845,048 (GRCm39) D679N probably damaging Het
Canx C T 11: 50,201,694 (GRCm39) V59I probably benign Het
Drd2 T C 9: 49,311,094 (GRCm39) V115A probably damaging Het
Eml6 T A 11: 29,768,907 (GRCm39) Q746L probably damaging Het
F13b G T 1: 139,434,582 (GRCm39) S116I probably benign Het
Flt4 T A 11: 49,515,555 (GRCm39) S48T probably benign Het
Gcn1 C A 5: 115,757,720 (GRCm39) S2475Y probably benign Het
Gls2 T C 10: 128,040,583 (GRCm39) L328P probably damaging Het
Gm7535 A G 17: 18,131,936 (GRCm39) probably benign Het
Htr3a T C 9: 48,819,911 (GRCm39) Y73C probably damaging Het
Iapp G A 6: 142,249,096 (GRCm39) A50T probably benign Het
Il10ra T C 9: 45,176,914 (GRCm39) D137G probably benign Het
Krt35 T C 11: 99,986,988 (GRCm39) S9G probably null Het
Lamc2 T A 1: 153,006,525 (GRCm39) R875S probably benign Het
Mcoln1 C A 8: 3,555,813 (GRCm39) T36K possibly damaging Het
Muc6 T C 7: 141,233,227 (GRCm39) H885R probably benign Het
Nsrp1 A T 11: 76,936,587 (GRCm39) Y536* probably null Het
Or10al4 A T 17: 38,037,145 (GRCm39) I77F probably damaging Het
Polr2a A G 11: 69,633,511 (GRCm39) probably null Het
Pp2d1 C A 17: 53,822,482 (GRCm39) V195L probably benign Het
Rag1 T C 2: 101,474,491 (GRCm39) H217R probably benign Het
Ramp2 A G 11: 101,138,457 (GRCm39) E86G probably benign Het
Rcbtb2 T C 14: 73,416,005 (GRCm39) probably null Het
Sema5a A T 15: 32,631,455 (GRCm39) I613F probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Slc39a11 C A 11: 113,450,376 (GRCm39) probably null Het
Slc47a2 T C 11: 61,204,497 (GRCm39) T285A probably benign Het
Timd2 T A 11: 46,577,844 (GRCm39) I96L probably damaging Het
Tkt G T 14: 30,289,018 (GRCm39) probably null Het
Tle1 A T 4: 72,117,556 (GRCm39) F35I possibly damaging Het
Tmem64 T C 4: 15,266,658 (GRCm39) I236T possibly damaging Het
Ttll13 A G 7: 79,902,250 (GRCm39) K109R probably damaging Het
Virma T C 4: 11,544,924 (GRCm39) S1628P probably damaging Het
Zan C A 5: 137,408,568 (GRCm39) probably benign Het
Zbtb22 T G 17: 34,136,939 (GRCm39) D361E probably damaging Het
Zfp608 T C 18: 55,120,756 (GRCm39) N277S probably benign Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTTATCTAGACTTCACATCGTTC -3'
(R):5'- CCCTTGTTTTCTAAGGTAGAGTCTC -3'

Sequencing Primer
(F):5'- CACATCGTTCATTTTGGCATAATGG -3'
(R):5'- GGTAGAGTCTCTATGTTGTCTCTCAC -3'
Posted On 2014-10-15