Incidental Mutation 'R2218:Gls2'
ID 241271
Institutional Source Beutler Lab
Gene Symbol Gls2
Ensembl Gene ENSMUSG00000044005
Gene Name glutaminase 2 (liver, mitochondrial)
Synonyms Lga, A330074B06Rik
MMRRC Submission 040220-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2218 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 128194457-128210004 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128204714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 328 (L328P)
Ref Sequence ENSEMBL: ENSMUSP00000047376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000143827] [ENSMUST00000159440]
AlphaFold Q571F8
Predicted Effect probably damaging
Transcript: ENSMUST00000044776
AA Change: L328P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: L328P

DomainStartEndE-ValueType
Pfam:Glutaminase 177 463 1.1e-116 PFAM
ANK 518 548 3.76e-5 SMART
ANK 552 581 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132441
SMART Domains Protein: ENSMUSP00000115788
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
Pfam:Glutaminase 1 37 7.9e-9 PFAM
ANK 92 122 3.76e-5 SMART
ANK 126 155 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134104
SMART Domains Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 60 172 1e-48 PDB
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135441
Predicted Effect probably benign
Transcript: ENSMUST00000143827
SMART Domains Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 135 5e-25 PDB
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152928
Predicted Effect probably benign
Transcript: ENSMUST00000159440
SMART Domains Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 134 9e-25 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,903,862 probably null Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atp13a5 A T 16: 29,321,646 V319D probably damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Brinp1 A G 4: 68,762,715 L526P probably damaging Het
Cacna1d C T 14: 30,123,091 D679N probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Drd2 T C 9: 49,399,794 V115A probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
F13b G T 1: 139,506,844 S116I probably benign Het
Fam206a G T 4: 56,802,693 V26L probably damaging Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gcn1l1 C A 5: 115,619,661 S2475Y probably benign Het
Gm7535 A G 17: 17,911,674 probably benign Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Iapp G A 6: 142,303,370 A50T probably benign Het
Il10ra T C 9: 45,265,616 D137G probably benign Het
Krt35 T C 11: 100,096,162 S9G probably null Het
Lamc2 T A 1: 153,130,779 R875S probably benign Het
Mcoln1 C A 8: 3,505,813 T36K possibly damaging Het
Muc6 T C 7: 141,646,960 H885R probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr120 A T 17: 37,726,254 I77F probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Rag1 T C 2: 101,644,146 H217R probably benign Het
Ramp2 A G 11: 101,247,631 E86G probably benign Het
Rcbtb2 T C 14: 73,178,565 probably null Het
Sema5a A T 15: 32,631,309 I613F probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slc39a11 C A 11: 113,559,550 probably null Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tkt G T 14: 30,567,061 probably null Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Ttll13 A G 7: 80,252,502 K109R probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Other mutations in Gls2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gls2 APN 10 128200971 splice site probably null
IGL00583:Gls2 APN 10 128204882 missense probably benign 0.11
IGL01444:Gls2 APN 10 128201347 missense probably damaging 1.00
IGL02746:Gls2 APN 10 128200956 missense probably damaging 1.00
R0015:Gls2 UTSW 10 128209350 missense probably damaging 1.00
R0024:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R0378:Gls2 UTSW 10 128207311 missense probably benign
R1179:Gls2 UTSW 10 128199234 missense probably damaging 1.00
R1227:Gls2 UTSW 10 128199664 missense probably damaging 1.00
R1421:Gls2 UTSW 10 128201348 nonsense probably null
R1750:Gls2 UTSW 10 128201325 missense probably damaging 1.00
R1952:Gls2 UTSW 10 128209362 missense probably benign
R2291:Gls2 UTSW 10 128207610 nonsense probably null
R2382:Gls2 UTSW 10 128203842 missense probably damaging 1.00
R4536:Gls2 UTSW 10 128200937 missense probably benign 0.00
R5305:Gls2 UTSW 10 128204709 nonsense probably null
R5435:Gls2 UTSW 10 128195126 intron probably benign
R5767:Gls2 UTSW 10 128205221 missense probably damaging 1.00
R7223:Gls2 UTSW 10 128199194 missense probably benign
R7767:Gls2 UTSW 10 128195129 missense unknown
R8068:Gls2 UTSW 10 128195114 missense unknown
R8084:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R8329:Gls2 UTSW 10 128201285 missense probably benign 0.00
R8872:Gls2 UTSW 10 128204666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGGTTCTGAAGTTCCCAC -3'
(R):5'- AGATCAAGGGCAGCCATCATG -3'

Sequencing Primer
(F):5'- GAAGTTCCCACTAATGCTCTGTGAG -3'
(R):5'- AGGGCAGCCATCATGTCCAC -3'
Posted On 2014-10-15