Incidental Mutation 'R2218:Flt4'
ID241274
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 040220-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2218 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49624728 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 48 (S48T)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably benign
Transcript: ENSMUST00000020617
AA Change: S48T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: S48T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152253
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,903,862 probably null Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atp13a5 A T 16: 29,321,646 V319D probably damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Brinp1 A G 4: 68,762,715 L526P probably damaging Het
Cacna1d C T 14: 30,123,091 D679N probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Drd2 T C 9: 49,399,794 V115A probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
F13b G T 1: 139,506,844 S116I probably benign Het
Fam206a G T 4: 56,802,693 V26L probably damaging Het
Gcn1l1 C A 5: 115,619,661 S2475Y probably benign Het
Gls2 T C 10: 128,204,714 L328P probably damaging Het
Gm7535 A G 17: 17,911,674 probably benign Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Iapp G A 6: 142,303,370 A50T probably benign Het
Il10ra T C 9: 45,265,616 D137G probably benign Het
Krt35 T C 11: 100,096,162 S9G probably null Het
Lamc2 T A 1: 153,130,779 R875S probably benign Het
Mcoln1 C A 8: 3,505,813 T36K possibly damaging Het
Muc6 T C 7: 141,646,960 H885R probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr120 A T 17: 37,726,254 I77F probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Rag1 T C 2: 101,644,146 H217R probably benign Het
Ramp2 A G 11: 101,247,631 E86G probably benign Het
Rcbtb2 T C 14: 73,178,565 probably null Het
Sema5a A T 15: 32,631,309 I613F probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slc39a11 C A 11: 113,559,550 probably null Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tkt G T 14: 30,567,061 probably null Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Ttll13 A G 7: 80,252,502 K109R probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TAGCCAAACTGCACATGGGG -3'
(R):5'- ATCTGTGCCTCTTCTGGGAG -3'

Sequencing Primer
(F):5'- ACTAGGCTGCCCTACCTTGAG -3'
(R):5'- GGAGACCACACTCTAGGACTC -3'
Posted On2014-10-15