Incidental Mutation 'R0165:Cyp2d22'
ID 24128
Institutional Source Beutler Lab
Gene Symbol Cyp2d22
Ensembl Gene ENSMUSG00000061740
Gene Name cytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms 2D22
MMRRC Submission 038441-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R0165 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 15
Chromosomal Location 82254728-82264461 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 82257481 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 228 (N228T)
Ref Sequence ENSEMBL: ENSMUSP00000023083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023083] [ENSMUST00000228986]
AlphaFold Q9JKY7
Predicted Effect probably benign
Transcript: ENSMUST00000023083
AA Change: N228T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023083
Gene: ENSMUSG00000061740
AA Change: N228T

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:p450 37 497 8.1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230663
Meta Mutation Damage Score 0.2747 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,213,924 (GRCm39) I717T possibly damaging Het
6430571L13Rik A G 9: 107,223,383 (GRCm39) probably benign Het
Abca15 T A 7: 119,950,126 (GRCm39) probably benign Het
Abca6 A G 11: 110,110,430 (GRCm39) V573A possibly damaging Het
Adgrl2 A G 3: 148,558,499 (GRCm39) probably benign Het
Agap3 A G 5: 24,684,743 (GRCm39) T544A probably damaging Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Akr1c20 T C 13: 4,573,295 (GRCm39) T7A probably benign Het
Ankrd26 A G 6: 118,517,445 (GRCm39) S459P probably benign Het
Armh4 A G 14: 50,011,243 (GRCm39) S155P probably benign Het
Ascc3 T A 10: 50,718,223 (GRCm39) probably null Het
Brd1 T C 15: 88,613,980 (GRCm39) N305S probably damaging Het
Catip T A 1: 74,407,628 (GRCm39) L320Q possibly damaging Het
Cplane1 G A 15: 8,245,866 (GRCm39) V1413M probably damaging Het
Cttnbp2 G A 6: 18,435,409 (GRCm39) Q150* probably null Het
Dapk1 T C 13: 60,909,407 (GRCm39) V1340A probably benign Het
Dcaf4 G A 12: 83,582,762 (GRCm39) probably benign Het
Ddhd1 G A 14: 45,833,049 (GRCm39) T849M probably damaging Het
Dnah6 A G 6: 72,998,306 (GRCm39) S3987P probably benign Het
Dst C A 1: 34,193,727 (GRCm39) probably benign Het
Epha2 T C 4: 141,049,203 (GRCm39) probably null Het
Ern2 T C 7: 121,779,002 (GRCm39) T281A probably benign Het
Extl1 A G 4: 134,085,014 (GRCm39) F652S probably damaging Het
Gckr A G 5: 31,484,292 (GRCm39) S541G possibly damaging Het
Gdap1l1 A G 2: 163,293,419 (GRCm39) probably null Het
Gm7535 T C 17: 18,131,437 (GRCm39) probably benign Het
Gmps T A 3: 63,901,375 (GRCm39) I398N probably damaging Het
Igf2r A G 17: 12,917,414 (GRCm39) V1556A probably benign Het
Il3ra T A 14: 14,350,967 (GRCm38) N283K probably benign Het
Ist1 A G 8: 110,401,998 (GRCm39) probably benign Het
Lama3 A T 18: 12,657,867 (GRCm39) I1934F probably damaging Het
Lars1 A T 18: 42,335,762 (GRCm39) M1118K possibly damaging Het
Lpin2 C T 17: 71,553,514 (GRCm39) S846L probably damaging Het
Lrrc4b C A 7: 44,111,739 (GRCm39) T537K probably damaging Het
Ltn1 G A 16: 87,202,407 (GRCm39) probably benign Het
Meiob A G 17: 25,054,135 (GRCm39) T401A probably benign Het
Mettl21e G A 1: 44,250,283 (GRCm39) T41M probably damaging Het
Miga1 C T 3: 151,996,480 (GRCm39) E323K probably damaging Het
Ndufs1 A T 1: 63,198,907 (GRCm39) probably null Het
Or5p62 T C 7: 107,771,882 (GRCm39) D23G probably benign Het
Otog G A 7: 45,953,655 (GRCm39) V2638M probably damaging Het
Parp6 T C 9: 59,540,208 (GRCm39) Y274H probably damaging Het
Prom2 A T 2: 127,381,434 (GRCm39) probably benign Het
Prune2 T A 19: 17,099,974 (GRCm39) M1826K probably benign Het
Qki T A 17: 10,457,892 (GRCm39) D159V probably damaging Het
Rab12 A T 17: 66,807,312 (GRCm39) I139N probably damaging Het
Rab25 T A 3: 88,455,362 (GRCm39) E7D probably benign Het
Rala A T 13: 18,063,174 (GRCm39) V139E probably benign Het
Ralgapa2 A G 2: 146,230,407 (GRCm39) probably benign Het
Rbl2 T A 8: 91,800,804 (GRCm39) Y89N probably damaging Het
Rho A T 6: 115,909,188 (GRCm39) I75F probably damaging Het
Slc38a4 C A 15: 96,906,830 (GRCm39) A303S probably benign Het
Slc6a15 A G 10: 103,245,670 (GRCm39) D551G probably null Het
Smyd3 T C 1: 178,871,437 (GRCm39) N314S probably benign Het
Speer4f1 T A 5: 17,684,512 (GRCm39) L180* probably null Het
Stat6 T C 10: 127,493,096 (GRCm39) V576A probably damaging Het
Strn T C 17: 78,984,803 (GRCm39) D127G possibly damaging Het
Syne1 T C 10: 4,983,096 (GRCm39) R8610G probably benign Het
Tbc1d7 A C 13: 43,306,678 (GRCm39) probably null Het
Tcf3 C T 10: 80,248,831 (GRCm39) R548Q probably damaging Het
Tlr9 C A 9: 106,103,286 (GRCm39) A859D probably benign Het
Tmem106c T A 15: 97,866,020 (GRCm39) probably benign Het
Tmprss11c A T 5: 86,379,786 (GRCm39) probably benign Het
Tnfsf18 A G 1: 161,322,300 (GRCm39) R7G probably benign Het
Tnrc6b T A 15: 80,742,871 (GRCm39) probably null Het
Trpm7 A T 2: 126,639,433 (GRCm39) F1684I probably damaging Het
Ttbk1 C A 17: 46,789,864 (GRCm39) R133L possibly damaging Het
Ttn A G 2: 76,551,686 (GRCm39) S22962P probably damaging Het
Ube2q1 T A 3: 89,683,460 (GRCm39) L135Q probably damaging Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vwce T C 19: 10,637,337 (GRCm39) probably benign Het
Wdhd1 A G 14: 47,504,525 (GRCm39) S350P probably benign Het
Zbtb21 A G 16: 97,752,604 (GRCm39) S560P probably damaging Het
Other mutations in Cyp2d22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Cyp2d22 APN 15 82,255,869 (GRCm39) missense probably damaging 1.00
IGL01750:Cyp2d22 APN 15 82,258,570 (GRCm39) missense probably benign 0.12
IGL01801:Cyp2d22 APN 15 82,257,046 (GRCm39) missense probably benign 0.41
IGL02449:Cyp2d22 APN 15 82,257,442 (GRCm39) missense probably benign 0.00
ANU22:Cyp2d22 UTSW 15 82,255,869 (GRCm39) missense probably damaging 1.00
R0294:Cyp2d22 UTSW 15 82,258,646 (GRCm39) missense possibly damaging 0.86
R1381:Cyp2d22 UTSW 15 82,256,709 (GRCm39) missense probably benign 0.00
R1479:Cyp2d22 UTSW 15 82,256,137 (GRCm39) missense probably damaging 0.97
R1562:Cyp2d22 UTSW 15 82,258,179 (GRCm39) missense probably damaging 0.99
R1968:Cyp2d22 UTSW 15 82,257,373 (GRCm39) missense probably benign 0.04
R1972:Cyp2d22 UTSW 15 82,260,028 (GRCm39) missense probably benign 0.11
R4492:Cyp2d22 UTSW 15 82,258,571 (GRCm39) missense probably benign 0.00
R4575:Cyp2d22 UTSW 15 82,256,133 (GRCm39) missense possibly damaging 0.94
R4702:Cyp2d22 UTSW 15 82,260,118 (GRCm39) missense probably damaging 1.00
R4703:Cyp2d22 UTSW 15 82,260,118 (GRCm39) missense probably damaging 1.00
R5344:Cyp2d22 UTSW 15 82,255,839 (GRCm39) missense possibly damaging 0.95
R5523:Cyp2d22 UTSW 15 82,256,772 (GRCm39) missense probably damaging 1.00
R5888:Cyp2d22 UTSW 15 82,258,014 (GRCm39) missense probably benign
R6060:Cyp2d22 UTSW 15 82,260,086 (GRCm39) missense probably benign 0.00
R6108:Cyp2d22 UTSW 15 82,256,106 (GRCm39) missense possibly damaging 0.59
R6146:Cyp2d22 UTSW 15 82,258,036 (GRCm39) critical splice acceptor site probably null
R6279:Cyp2d22 UTSW 15 82,258,169 (GRCm39) missense probably damaging 1.00
R6563:Cyp2d22 UTSW 15 82,256,113 (GRCm39) missense probably damaging 1.00
R7597:Cyp2d22 UTSW 15 82,260,053 (GRCm39) missense probably damaging 1.00
R7709:Cyp2d22 UTSW 15 82,258,612 (GRCm39) missense possibly damaging 0.88
R7839:Cyp2d22 UTSW 15 82,256,772 (GRCm39) missense probably damaging 1.00
R8094:Cyp2d22 UTSW 15 82,258,556 (GRCm39) missense probably benign 0.19
R8302:Cyp2d22 UTSW 15 82,256,021 (GRCm39) critical splice donor site probably null
R8515:Cyp2d22 UTSW 15 82,258,113 (GRCm39) missense probably benign 0.27
R9245:Cyp2d22 UTSW 15 82,256,748 (GRCm39) missense probably damaging 0.97
R9323:Cyp2d22 UTSW 15 82,258,207 (GRCm39) missense probably damaging 1.00
R9521:Cyp2d22 UTSW 15 82,256,688 (GRCm39) missense probably damaging 1.00
Z1186:Cyp2d22 UTSW 15 82,260,086 (GRCm39) missense probably benign 0.00
Z1190:Cyp2d22 UTSW 15 82,260,086 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAGGAAGGCATCAGTCAAATC -3'
(R):5'- GCTGGGGTCAAGTGCTCGAAAATG -3'

Sequencing Primer
(F):5'- TTTTCCCAGGGAAGACCTTG -3'
(R):5'- AAAATGGTGCCTGTGCTCC -3'
Posted On 2013-04-16