Incidental Mutation 'R2218:Gm7535'
ID241289
Institutional Source Beutler Lab
Gene Symbol Gm7535
Ensembl Gene ENSMUSG00000090957
Gene Namepredicted gene 7535
Synonyms
MMRRC Submission 040220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R2218 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17911039-17911947 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 17911674 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054871] [ENSMUST00000164167]
Predicted Effect probably benign
Transcript: ENSMUST00000054871
SMART Domains Protein: ENSMUSP00000093316
Gene: ENSMUSG00000079700

DomainStartEndE-ValueType
Pfam:7tm_1 43 302 2.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164167
SMART Domains Protein: ENSMUSP00000125897
Gene: ENSMUSG00000090957

DomainStartEndE-ValueType
Pfam:CNDH2_C 15 292 6.7e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231820
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,903,862 probably null Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atp13a5 A T 16: 29,321,646 V319D probably damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Brinp1 A G 4: 68,762,715 L526P probably damaging Het
Cacna1d C T 14: 30,123,091 D679N probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Drd2 T C 9: 49,399,794 V115A probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
F13b G T 1: 139,506,844 S116I probably benign Het
Fam206a G T 4: 56,802,693 V26L probably damaging Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gcn1l1 C A 5: 115,619,661 S2475Y probably benign Het
Gls2 T C 10: 128,204,714 L328P probably damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Iapp G A 6: 142,303,370 A50T probably benign Het
Il10ra T C 9: 45,265,616 D137G probably benign Het
Krt35 T C 11: 100,096,162 S9G probably null Het
Lamc2 T A 1: 153,130,779 R875S probably benign Het
Mcoln1 C A 8: 3,505,813 T36K possibly damaging Het
Muc6 T C 7: 141,646,960 H885R probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr120 A T 17: 37,726,254 I77F probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Rag1 T C 2: 101,644,146 H217R probably benign Het
Ramp2 A G 11: 101,247,631 E86G probably benign Het
Rcbtb2 T C 14: 73,178,565 probably null Het
Sema5a A T 15: 32,631,309 I613F probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slc39a11 C A 11: 113,559,550 probably null Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tkt G T 14: 30,567,061 probably null Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Ttll13 A G 7: 80,252,502 K109R probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Other mutations in Gm7535
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Gm7535 APN 17 17911888 intron probably benign
IGL01663:Gm7535 APN 17 17911357 intron probably benign
R0165:Gm7535 UTSW 17 17911175 intron probably benign
R0335:Gm7535 UTSW 17 17911112 intron probably benign
R1985:Gm7535 UTSW 17 17911538 intron probably benign
R2217:Gm7535 UTSW 17 17911674 intron probably benign
R4464:Gm7535 UTSW 17 17911662 intron probably benign
R4581:Gm7535 UTSW 17 17911083 intron probably benign
R4887:Gm7535 UTSW 17 17911071 intron probably benign
R5225:Gm7535 UTSW 17 17911547 intron probably benign
R5305:Gm7535 UTSW 17 17911799 intron probably benign
R5641:Gm7535 UTSW 17 17911526 intron probably benign
R5658:Gm7535 UTSW 17 17911320 intron probably benign
R5760:Gm7535 UTSW 17 17911818 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCATCAAGGTCAGCAGC -3'
(R):5'- ATCTAAGGTCCTCCAGAAAGGG -3'

Sequencing Primer
(F):5'- AAAGTCATCTGCTACCCC -3'
(R):5'- GGAAACCCTATTCTGTGCCAC -3'
Posted On2014-10-15