Mutagenetix > Incidental Mutation

Incidental Mutation 'R0165:Brd1'

24129

Institutional Source

Beutler Lab

Gene Symbol

Brd1

Ensembl Gene

ENSMUSG00000022387

Gene Name

bromodomain containing 1

Synonyms

1110059H06Rik

MMRRC Submission

038441-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0165 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

88687034-88734233 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88729777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 305 (N305S)

Ref Sequence

ENSEMBL: ENSMUSP00000105007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088911] [ENSMUST00000109380] [ENSMUST00000109381]

AlphaFold

G5E8P1

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000088911

SMART Domains

Protein: ENSMUSP00000086300
Gene: ENSMUSG00000022387

Domain	Start	End	E-Value	Type
Pfam:EPL1	46	196	1.3e-38	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109380
AA Change: N305S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387
AA Change: N305S

Domain	Start	End	E-Value	Type
Pfam:EPL1	46	196	3.3e-38	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC
low complexity region	836	869	N/A	INTRINSIC
PWWP	927	1010	2.25e-39	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109381
AA Change: N305S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387
AA Change: N305S

Domain	Start	End	E-Value	Type
Pfam:EPL1	47	196	3.9e-37	PFAM
PHD	216	262	3.17e-7	SMART
PHD	326	389	5.16e-7	SMART
low complexity region	415	436	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	532	551	N/A	INTRINSIC
BROMO	560	668	8.59e-39	SMART
coiled coil region	704	726	N/A	INTRINSIC
low complexity region	857	876	N/A	INTRINSIC
low complexity region	887	898	N/A	INTRINSIC
low complexity region	967	1000	N/A	INTRINSIC
PWWP	1058	1141	2.25e-39	SMART

Meta Mutation Damage Score

0.8877

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.2%
20x: 91.4%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,216,382	V1413M	probably damaging	Het
2700049A03Rik	T	C	12: 71,167,150	I717T	possibly damaging	Het
3632451O06Rik	A	G	14: 49,773,786	S155P	probably benign	Het
6430571L13Rik	A	G	9: 107,346,184		probably benign	Het
Abca15	T	A	7: 120,350,903		probably benign	Het
Abca6	A	G	11: 110,219,604	V573A	possibly damaging	Het
Adgrl2	A	G	3: 148,852,863		probably benign	Het
Agap3	A	G	5: 24,479,745	T544A	probably damaging	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Akr1c20	T	C	13: 4,523,296	T7A	probably benign	Het
Ankrd26	A	G	6: 118,540,484	S459P	probably benign	Het
Ascc3	T	A	10: 50,842,127		probably null	Het
Catip	T	A	1: 74,368,469	L320Q	possibly damaging	Het
Cttnbp2	G	A	6: 18,435,410	Q150*	probably null	Het
Cyp2d22	T	G	15: 82,373,280	N228T	probably benign	Het
Dapk1	T	C	13: 60,761,593	V1340A	probably benign	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Ddhd1	G	A	14: 45,595,592	T849M	probably damaging	Het
Dnah6	A	G	6: 73,021,323	S3987P	probably benign	Het
Dst	C	A	1: 34,154,646		probably benign	Het
Epha2	T	C	4: 141,321,892		probably null	Het
Ern2	T	C	7: 122,179,779	T281A	probably benign	Het
Extl1	A	G	4: 134,357,703	F652S	probably damaging	Het
Gckr	A	G	5: 31,326,948	S541G	possibly damaging	Het
Gdap1l1	A	G	2: 163,451,499		probably null	Het
Gm7535	T	C	17: 17,911,175		probably benign	Het
Gmps	T	A	3: 63,993,954	I398N	probably damaging	Het
Igf2r	A	G	17: 12,698,527	V1556A	probably benign	Het
Il3ra	T	A	14: 14,350,967	N283K	probably benign	Het
Ist1	A	G	8: 109,675,366		probably benign	Het
Lama3	A	T	18: 12,524,810	I1934F	probably damaging	Het
Lars	A	T	18: 42,202,697	M1118K	possibly damaging	Het
Lpin2	C	T	17: 71,246,519	S846L	probably damaging	Het
Lrrc4b	C	A	7: 44,462,315	T537K	probably damaging	Het
Ltn1	G	A	16: 87,405,519		probably benign	Het
Meiob	A	G	17: 24,835,161	T401A	probably benign	Het
Mettl21e	G	A	1: 44,211,123	T41M	probably damaging	Het
Miga1	C	T	3: 152,290,843	E323K	probably damaging	Het
Ndufs1	A	T	1: 63,159,748		probably null	Het
Olfr486	T	C	7: 108,172,675	D23G	probably benign	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Parp6	T	C	9: 59,632,925	Y274H	probably damaging	Het
Prom2	A	T	2: 127,539,514		probably benign	Het
Prune2	T	A	19: 17,122,610	M1826K	probably benign	Het
Qk	T	A	17: 10,238,963	D159V	probably damaging	Het
Rab12	A	T	17: 66,500,317	I139N	probably damaging	Het
Rab25	T	A	3: 88,548,055	E7D	probably benign	Het
Rala	A	T	13: 17,888,589	V139E	probably benign	Het
Ralgapa2	A	G	2: 146,388,487		probably benign	Het
Rbl2	T	A	8: 91,074,176	Y89N	probably damaging	Het
Rho	A	T	6: 115,932,227	I75F	probably damaging	Het
Slc38a4	C	A	15: 97,008,949	A303S	probably benign	Het
Slc6a15	A	G	10: 103,409,809	D551G	probably null	Het
Smyd3	T	C	1: 179,043,872	N314S	probably benign	Het
Speer4f1	T	A	5: 17,479,514	L180*	probably null	Het
Stat6	T	C	10: 127,657,227	V576A	probably damaging	Het
Strn	T	C	17: 78,677,374	D127G	possibly damaging	Het
Syne1	T	C	10: 5,033,096	R8610G	probably benign	Het
Tbc1d7	A	C	13: 43,153,202		probably null	Het
Tcf3	C	T	10: 80,412,997	R548Q	probably damaging	Het
Tlr9	C	A	9: 106,226,087	A859D	probably benign	Het
Tmem106c	T	A	15: 97,968,139		probably benign	Het
Tmprss11c	A	T	5: 86,231,927		probably benign	Het
Tnfsf18	A	G	1: 161,494,731	R7G	probably benign	Het
Tnrc6b	T	A	15: 80,858,670		probably null	Het
Trpm7	A	T	2: 126,797,513	F1684I	probably damaging	Het
Ttbk1	C	A	17: 46,478,938	R133L	possibly damaging	Het
Ttn	A	G	2: 76,721,342	S22962P	probably damaging	Het
Ube2q1	T	A	3: 89,776,153	L135Q	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vwce	T	C	19: 10,659,973		probably benign	Het
Wdhd1	A	G	14: 47,267,068	S350P	probably benign	Het
Zbtb21	A	G	16: 97,951,404	S560P	probably damaging	Het

Other mutations in Brd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Brd1	APN	15	88730158	missense	probably benign	0.38
IGL00924:Brd1	APN	15	88729409	missense	possibly damaging	0.80
IGL01626:Brd1	APN	15	88700887	missense	probably damaging	1.00
IGL02569:Brd1	APN	15	88713929	missense	probably damaging	1.00
IGL02646:Brd1	APN	15	88700877	missense	probably damaging	1.00
IGL03130:Brd1	APN	15	88688374	missense	probably benign
IGL03343:Brd1	APN	15	88707251	missense	possibly damaging	0.89
spry	UTSW	15	88688355	missense	possibly damaging	0.47
R0089:Brd1	UTSW	15	88701198	missense	probably benign	0.06
R0112:Brd1	UTSW	15	88730383	missense	probably benign
R0965:Brd1	UTSW	15	88717028	missense	probably damaging	1.00
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1195:Brd1	UTSW	15	88700811	missense	probably benign	0.12
R1534:Brd1	UTSW	15	88689663	missense	possibly damaging	0.68
R2245:Brd1	UTSW	15	88689860	critical splice donor site	probably null
R3611:Brd1	UTSW	15	88700944	missense	probably benign
R3751:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3752:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3753:Brd1	UTSW	15	88689618	missense	possibly damaging	0.83
R3801:Brd1	UTSW	15	88717040	missense	probably damaging	1.00
R4956:Brd1	UTSW	15	88730113	missense	probably damaging	1.00
R5382:Brd1	UTSW	15	88729564	missense	probably damaging	1.00
R5546:Brd1	UTSW	15	88701122	missense	probably benign	0.00
R5659:Brd1	UTSW	15	88713381	missense	probably benign	0.14
R5730:Brd1	UTSW	15	88717045	missense	probably benign	0.05
R5773:Brd1	UTSW	15	88689549	missense	probably benign	0.14
R6224:Brd1	UTSW	15	88688355	missense	possibly damaging	0.47
R6371:Brd1	UTSW	15	88713998	missense	probably benign
R7096:Brd1	UTSW	15	88713935	missense	probably damaging	1.00
R7722:Brd1	UTSW	15	88729559	missense	probably damaging	1.00
R8782:Brd1	UTSW	15	88730631	nonsense	probably null
R8869:Brd1	UTSW	15	88730526	missense	probably benign	0.09
R9079:Brd1	UTSW	15	88713950	missense	probably damaging	1.00
R9116:Brd1	UTSW	15	88701171	missense	possibly damaging	0.96
R9351:Brd1	UTSW	15	88730104	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GGGCACATGTCACATGGAATGCTG -3'
(R):5'- TGAGGACGCTGTTTGCTGCATC -3'

Sequencing Primer
(F):5'- CTGTGTAGCAATTTGCTTTGTG -3'
(R):5'- CTGTGACATGTGCAACCTG -3'

Posted On

2013-04-16