Incidental Mutation 'R2219:Cfap65'
ID 241298
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 040221-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R2219 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74943184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1614 (I1614V)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083682
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: I1614V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: I1614V

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,095,769 (GRCm39) Y160H probably damaging Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adgre1 T A 17: 57,708,912 (GRCm39) N34K possibly damaging Het
Ago2 T A 15: 73,018,260 (GRCm39) E59D probably benign Het
Akap8l G T 17: 32,553,605 (GRCm39) Q372K probably benign Het
Aox1 A G 1: 58,388,289 (GRCm39) probably null Het
Apc2 T C 10: 80,144,943 (GRCm39) V618A probably benign Het
Cacna1d A T 14: 29,764,047 (GRCm39) C2140S probably damaging Het
Cadps2 A G 6: 23,410,831 (GRCm39) L671P probably damaging Het
Capn9 C T 8: 125,335,898 (GRCm39) R529* probably null Het
Ccdc180 T A 4: 45,944,949 (GRCm39) N1452K probably damaging Het
Cdh5 A T 8: 104,869,538 (GRCm39) I755F possibly damaging Het
Cdkal1 T A 13: 29,538,741 (GRCm39) M473L probably benign Het
Champ1 A G 8: 13,930,017 (GRCm39) H725R probably damaging Het
Cntnap5a A T 1: 116,508,369 (GRCm39) T1294S possibly damaging Het
Cops8 A C 1: 90,534,341 (GRCm39) N94T probably benign Het
Cpne7 G T 8: 123,851,177 (GRCm39) V155L probably benign Het
Dhx29 T C 13: 113,089,338 (GRCm39) V703A probably damaging Het
Dhx30 A G 9: 109,916,703 (GRCm39) L575P probably damaging Het
Dmc1 T A 15: 79,469,327 (GRCm39) H156L possibly damaging Het
Dnmt3a A G 12: 3,899,654 (GRCm39) probably benign Het
Dst C G 1: 34,209,514 (GRCm39) L869V probably damaging Het
Eif3d A T 15: 77,849,142 (GRCm39) M180K probably benign Het
Erbb3 T C 10: 128,405,740 (GRCm39) T1173A probably damaging Het
Fat4 A T 3: 39,064,364 (GRCm39) K4773N probably damaging Het
Fbn2 G A 18: 58,186,035 (GRCm39) P1771L possibly damaging Het
Fer1l4 T G 2: 155,873,684 (GRCm39) Y1207S probably damaging Het
Fermt2 G A 14: 45,713,354 (GRCm39) T87I probably benign Het
Fpr3 T A 17: 18,191,644 (GRCm39) M305K possibly damaging Het
Fzd2 A G 11: 102,496,249 (GRCm39) E231G probably benign Het
Ggcx T C 6: 72,404,965 (GRCm39) Y458H probably benign Het
Ggt7 A G 2: 155,337,639 (GRCm39) S504P probably damaging Het
Gm4884 A G 7: 40,692,910 (GRCm39) H293R possibly damaging Het
Gm5475 A G 15: 100,322,094 (GRCm39) probably benign Het
Gm5930 A T 14: 44,573,993 (GRCm39) L115M probably damaging Het
Itln1 T A 1: 171,359,115 (GRCm39) T122S probably damaging Het
Itpr3 T A 17: 27,334,027 (GRCm39) L2033Q probably benign Het
Lama2 T C 10: 26,919,565 (GRCm39) D2222G probably damaging Het
Lars2 T C 9: 123,247,845 (GRCm39) L334P probably damaging Het
Ly9 T C 1: 171,425,249 (GRCm39) probably null Het
Man1a T C 10: 53,853,145 (GRCm39) I324M probably damaging Het
Mast3 T C 8: 71,233,607 (GRCm39) E994G probably damaging Het
Mettl21a A T 1: 64,655,442 (GRCm39) V46E probably damaging Het
Mmp15 A G 8: 96,096,801 (GRCm39) D398G probably benign Het
Mybpc1 T A 10: 88,391,540 (GRCm39) D319V probably damaging Het
Or10ad1c T A 15: 98,084,848 (GRCm39) K277* probably null Het
Or4a47 A T 2: 89,665,769 (GRCm39) D173E probably damaging Het
Or4a78 A T 2: 89,498,211 (GRCm39) N6K possibly damaging Het
Or4c35 G A 2: 89,808,256 (GRCm39) V45I possibly damaging Het
Or4f61 A T 2: 111,922,752 (GRCm39) I98N probably damaging Het
Or5b113 T A 19: 13,342,901 (GRCm39) I303N possibly damaging Het
Or5p5 G A 7: 107,414,429 (GRCm39) V213I probably benign Het
Or9m1 A C 2: 87,733,269 (GRCm39) Y250* probably null Het
Otogl C T 10: 107,692,838 (GRCm39) C882Y probably damaging Het
Parp10 A G 15: 76,117,783 (GRCm39) Y868H probably damaging Het
Pick1 T A 15: 79,123,899 (GRCm39) I90N probably damaging Het
Piezo1 C T 8: 123,218,227 (GRCm39) V1170I probably benign Het
Pim3 G A 15: 88,747,115 (GRCm39) V54I possibly damaging Het
Pinlyp T C 7: 24,245,433 (GRCm39) probably benign Het
Pira12 A T 7: 3,900,488 (GRCm39) N87K probably benign Het
Ppfia3 G A 7: 45,004,314 (GRCm39) Q473* probably null Het
Rab3gap2 G A 1: 185,008,113 (GRCm39) G1056E probably damaging Het
Ralgapa2 G A 2: 146,263,599 (GRCm39) T706I probably benign Het
Reln T C 5: 22,177,045 (GRCm39) T1874A possibly damaging Het
Rftn1 C A 17: 50,476,173 (GRCm39) M1I probably null Het
Ros1 T A 10: 52,042,175 (GRCm39) Q250L probably damaging Het
Slc11a1 T A 1: 74,419,824 (GRCm39) F166I probably damaging Het
Slc17a9 A G 2: 180,373,755 (GRCm39) T59A probably benign Het
Slc26a5 T C 5: 22,028,476 (GRCm39) K364R probably damaging Het
Slitrk2 T C X: 65,698,754 (GRCm39) I415T probably damaging Het
Stom A G 2: 35,211,613 (GRCm39) I136T possibly damaging Het
Strc G T 2: 121,195,004 (GRCm39) P1728T probably damaging Het
Telo2 C A 17: 25,322,673 (GRCm39) V640F probably benign Het
Tg T C 15: 66,553,782 (GRCm39) V399A probably benign Het
Tmem214 A G 5: 31,030,975 (GRCm39) K383E possibly damaging Het
Tomm40l A T 1: 171,049,550 (GRCm39) L13* probably null Het
Tonsl A T 15: 76,518,840 (GRCm39) N526K probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tymp T A 15: 89,258,965 (GRCm39) M240L probably benign Het
Ubr2 A T 17: 47,296,968 (GRCm39) S271T possibly damaging Het
Uggt2 A T 14: 119,312,749 (GRCm39) N353K probably damaging Het
Ugt2b35 T A 5: 87,151,191 (GRCm39) F266I possibly damaging Het
Vmn2r103 C T 17: 20,013,909 (GRCm39) R234W probably damaging Het
Zfp109 C A 7: 23,927,886 (GRCm39) D508Y probably damaging Het
Zfp623 T C 15: 75,819,379 (GRCm39) S112P possibly damaging Het
Zfp735 A G 11: 73,601,851 (GRCm39) N265S possibly damaging Het
Zfp879 A G 11: 50,724,094 (GRCm39) C321R probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGATTCAGGCTGAAGG -3'
(R):5'- TACCAGCATGCCTTGTACC -3'

Sequencing Primer
(F):5'- GCCCACCTAGCTAGCTCTAGTAG -3'
(R):5'- CCCATTGCTACAGCCTAGTAG -3'
Posted On 2014-10-15