Incidental Mutation 'R0165:Zbtb21'
ID 24132
Institutional Source Beutler Lab
Gene Symbol Zbtb21
Ensembl Gene ENSMUSG00000046962
Gene Name zinc finger and BTB domain containing 21
Synonyms Zfp295, B430213I24Rik, 5430437K12Rik, Znf295
MMRRC Submission 038441-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.751) question?
Stock # R0165 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 16
Chromosomal Location 97943357-97962622 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 97951404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 560 (S560P)
Ref Sequence ENSEMBL: ENSMUSP00000068283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052089] [ENSMUST00000063605] [ENSMUST00000113734] [ENSMUST00000231263] [ENSMUST00000231560] [ENSMUST00000232165] [ENSMUST00000232187]
AlphaFold E9Q444
Predicted Effect probably benign
Transcript: ENSMUST00000052089
SMART Domains Protein: ENSMUSP00000052127
Gene: ENSMUSG00000046962

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 578 598 2.14e2 SMART
ZnF_C2H2 605 628 8.67e-1 SMART
low complexity region 708 728 N/A INTRINSIC
ZnF_C2H2 737 757 2.06e1 SMART
ZnF_C2H2 765 787 4.65e-1 SMART
low complexity region 804 829 N/A INTRINSIC
ZnF_C2H2 871 893 1.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063605
AA Change: S560P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068283
Gene: ENSMUSG00000046962
AA Change: S560P

DomainStartEndE-ValueType
BTB 30 126 5.14e-18 SMART
low complexity region 433 442 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
ZnF_C2H2 549 572 8.09e-1 SMART
ZnF_C2H2 578 601 2.63e0 SMART
ZnF_C2H2 673 695 3.58e-2 SMART
ZnF_C2H2 750 770 2.14e2 SMART
ZnF_C2H2 777 800 8.67e-1 SMART
low complexity region 880 900 N/A INTRINSIC
ZnF_C2H2 909 929 2.06e1 SMART
ZnF_C2H2 937 959 4.65e-1 SMART
low complexity region 976 1001 N/A INTRINSIC
ZnF_C2H2 1043 1065 1.79e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113734
AA Change: S588P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109363
Gene: ENSMUSG00000046962
AA Change: S588P

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 577 600 8.09e-1 SMART
ZnF_C2H2 606 629 2.63e0 SMART
ZnF_C2H2 701 723 3.58e-2 SMART
ZnF_C2H2 778 798 2.14e2 SMART
ZnF_C2H2 805 828 8.67e-1 SMART
low complexity region 908 928 N/A INTRINSIC
ZnF_C2H2 937 957 2.06e1 SMART
ZnF_C2H2 965 987 4.65e-1 SMART
low complexity region 1004 1029 N/A INTRINSIC
ZnF_C2H2 1071 1093 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231256
Predicted Effect probably benign
Transcript: ENSMUST00000231263
Predicted Effect probably benign
Transcript: ENSMUST00000231560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232010
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect probably benign
Transcript: ENSMUST00000232187
Meta Mutation Damage Score 0.4012 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 (GRCm38) V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 (GRCm38) I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 (GRCm38) S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 (GRCm38) probably benign Het
Abca15 T A 7: 120,350,903 (GRCm38) probably benign Het
Abca6 A G 11: 110,219,604 (GRCm38) V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 (GRCm38) probably benign Het
Agap3 A G 5: 24,479,745 (GRCm38) T544A probably damaging Het
Ahrr G A 13: 74,283,024 (GRCm38) probably benign Het
Akr1c20 T C 13: 4,523,296 (GRCm38) T7A probably benign Het
Ankrd26 A G 6: 118,540,484 (GRCm38) S459P probably benign Het
Ascc3 T A 10: 50,842,127 (GRCm38) probably null Het
Brd1 T C 15: 88,729,777 (GRCm38) N305S probably damaging Het
Catip T A 1: 74,368,469 (GRCm38) L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 (GRCm38) Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 (GRCm38) N228T probably benign Het
Dapk1 T C 13: 60,761,593 (GRCm38) V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 (GRCm38) probably benign Het
Ddhd1 G A 14: 45,595,592 (GRCm38) T849M probably damaging Het
Dnah6 A G 6: 73,021,323 (GRCm38) S3987P probably benign Het
Dst C A 1: 34,154,646 (GRCm38) probably benign Het
Epha2 T C 4: 141,321,892 (GRCm38) probably null Het
Ern2 T C 7: 122,179,779 (GRCm38) T281A probably benign Het
Extl1 A G 4: 134,357,703 (GRCm38) F652S probably damaging Het
Gckr A G 5: 31,326,948 (GRCm38) S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 (GRCm38) probably null Het
Gm7535 T C 17: 17,911,175 (GRCm38) probably benign Het
Gmps T A 3: 63,993,954 (GRCm38) I398N probably damaging Het
Igf2r A G 17: 12,698,527 (GRCm38) V1556A probably benign Het
Il3ra T A 14: 14,350,967 (GRCm38) N283K probably benign Het
Ist1 A G 8: 109,675,366 (GRCm38) probably benign Het
Lama3 A T 18: 12,524,810 (GRCm38) I1934F probably damaging Het
Lars A T 18: 42,202,697 (GRCm38) M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 (GRCm38) S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 (GRCm38) T537K probably damaging Het
Ltn1 G A 16: 87,405,519 (GRCm38) probably benign Het
Meiob A G 17: 24,835,161 (GRCm38) T401A probably benign Het
Mettl21e G A 1: 44,211,123 (GRCm38) T41M probably damaging Het
Miga1 C T 3: 152,290,843 (GRCm38) E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 (GRCm38) probably null Het
Olfr486 T C 7: 108,172,675 (GRCm38) D23G probably benign Het
Otog G A 7: 46,304,231 (GRCm38) V2638M probably damaging Het
Parp6 T C 9: 59,632,925 (GRCm38) Y274H probably damaging Het
Prom2 A T 2: 127,539,514 (GRCm38) probably benign Het
Prune2 T A 19: 17,122,610 (GRCm38) M1826K probably benign Het
Qk T A 17: 10,238,963 (GRCm38) D159V probably damaging Het
Rab12 A T 17: 66,500,317 (GRCm38) I139N probably damaging Het
Rab25 T A 3: 88,548,055 (GRCm38) E7D probably benign Het
Rala A T 13: 17,888,589 (GRCm38) V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 (GRCm38) probably benign Het
Rbl2 T A 8: 91,074,176 (GRCm38) Y89N probably damaging Het
Rho A T 6: 115,932,227 (GRCm38) I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 (GRCm38) A303S probably benign Het
Slc6a15 A G 10: 103,409,809 (GRCm38) D551G probably null Het
Smyd3 T C 1: 179,043,872 (GRCm38) N314S probably benign Het
Speer4f1 T A 5: 17,479,514 (GRCm38) L180* probably null Het
Stat6 T C 10: 127,657,227 (GRCm38) V576A probably damaging Het
Strn T C 17: 78,677,374 (GRCm38) D127G possibly damaging Het
Syne1 T C 10: 5,033,096 (GRCm38) R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 (GRCm38) probably null Het
Tcf3 C T 10: 80,412,997 (GRCm38) R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 (GRCm38) A859D probably benign Het
Tmem106c T A 15: 97,968,139 (GRCm38) probably benign Het
Tmprss11c A T 5: 86,231,927 (GRCm38) probably benign Het
Tnfsf18 A G 1: 161,494,731 (GRCm38) R7G probably benign Het
Tnrc6b T A 15: 80,858,670 (GRCm38) probably null Het
Trpm7 A T 2: 126,797,513 (GRCm38) F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 (GRCm38) R133L possibly damaging Het
Ttn A G 2: 76,721,342 (GRCm38) S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 (GRCm38) L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 (GRCm38) A182T probably benign Het
Vwce T C 19: 10,659,973 (GRCm38) probably benign Het
Wdhd1 A G 14: 47,267,068 (GRCm38) S350P probably benign Het
Other mutations in Zbtb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Zbtb21 APN 16 97,952,320 (GRCm38) missense probably benign 0.03
IGL00921:Zbtb21 APN 16 97,952,022 (GRCm38) missense probably damaging 1.00
IGL01825:Zbtb21 APN 16 97,952,689 (GRCm38) missense possibly damaging 0.63
IGL02310:Zbtb21 APN 16 97,951,790 (GRCm38) missense possibly damaging 0.89
IGL03126:Zbtb21 APN 16 97,951,745 (GRCm38) missense probably damaging 1.00
IGL03332:Zbtb21 APN 16 97,952,333 (GRCm38) missense possibly damaging 0.94
R0184:Zbtb21 UTSW 16 97,950,513 (GRCm38) missense probably damaging 1.00
R0267:Zbtb21 UTSW 16 97,952,100 (GRCm38) missense probably damaging 1.00
R0734:Zbtb21 UTSW 16 97,952,627 (GRCm38) missense probably damaging 1.00
R1546:Zbtb21 UTSW 16 97,952,027 (GRCm38) missense probably damaging 0.97
R1565:Zbtb21 UTSW 16 97,952,427 (GRCm38) missense probably benign 0.00
R1778:Zbtb21 UTSW 16 97,950,585 (GRCm38) missense probably benign 0.02
R2049:Zbtb21 UTSW 16 97,950,155 (GRCm38) missense probably damaging 1.00
R4086:Zbtb21 UTSW 16 97,952,763 (GRCm38) missense probably damaging 1.00
R4619:Zbtb21 UTSW 16 97,949,892 (GRCm38) missense possibly damaging 0.95
R4620:Zbtb21 UTSW 16 97,949,892 (GRCm38) missense possibly damaging 0.95
R4754:Zbtb21 UTSW 16 97,951,266 (GRCm38) missense probably damaging 1.00
R4785:Zbtb21 UTSW 16 97,950,455 (GRCm38) missense possibly damaging 0.60
R5466:Zbtb21 UTSW 16 97,950,498 (GRCm38) missense possibly damaging 0.66
R5989:Zbtb21 UTSW 16 97,951,499 (GRCm38) missense probably damaging 1.00
R6374:Zbtb21 UTSW 16 97,950,368 (GRCm38) missense probably damaging 0.98
R6469:Zbtb21 UTSW 16 97,956,772 (GRCm38) missense probably benign 0.01
R6732:Zbtb21 UTSW 16 97,951,082 (GRCm38) missense probably damaging 0.97
R6830:Zbtb21 UTSW 16 97,951,961 (GRCm38) missense probably damaging 1.00
R7123:Zbtb21 UTSW 16 97,949,912 (GRCm38) missense probably damaging 0.96
R7129:Zbtb21 UTSW 16 97,951,687 (GRCm38) small deletion probably benign
R7261:Zbtb21 UTSW 16 97,952,979 (GRCm38) missense possibly damaging 0.46
R7305:Zbtb21 UTSW 16 97,951,295 (GRCm38) missense possibly damaging 0.92
R7372:Zbtb21 UTSW 16 97,950,369 (GRCm38) missense possibly damaging 0.55
R7564:Zbtb21 UTSW 16 97,951,540 (GRCm38) nonsense probably null
R7670:Zbtb21 UTSW 16 97,951,877 (GRCm38) missense probably damaging 0.99
R7788:Zbtb21 UTSW 16 97,951,454 (GRCm38) missense possibly damaging 0.62
R8142:Zbtb21 UTSW 16 97,951,475 (GRCm38) missense probably damaging 0.98
R8547:Zbtb21 UTSW 16 97,952,115 (GRCm38) missense possibly damaging 0.46
R8822:Zbtb21 UTSW 16 97,951,316 (GRCm38) missense probably damaging 0.99
R8823:Zbtb21 UTSW 16 97,951,316 (GRCm38) missense probably damaging 0.99
R9675:Zbtb21 UTSW 16 97,951,745 (GRCm38) missense probably damaging 1.00
X0022:Zbtb21 UTSW 16 97,952,075 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAATGTAGGCCCCTTTGGCTC -3'
(R):5'- AGGTTCCAGACAGACAGAAGGTCAC -3'

Sequencing Primer
(F):5'- GCGCCTCAGCTTAATGATCAG -3'
(R):5'- GGTCACCCTTGAAGAAGGC -3'
Posted On 2013-04-16