Mutagenetix > Incidental Mutation

Incidental Mutation 'R2219:Cadps2'

241324

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

040221-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2219 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23410832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 671 (L671P)

Ref Sequence

ENSEMBL: ENSMUSP00000125972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018122
AA Change: L700P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: L700P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000069074
AA Change: L703P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: L703P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115356
AA Change: L700P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: L700P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115358
AA Change: L700P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: L700P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115361
AA Change: L700P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: L700P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125350
AA Change: L345P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: L345P

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000142913
AA Change: L671P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: L671P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163871
AA Change: L700P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: L700P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166458
AA Change: L671P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: L671P

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	A	G	7: 42,446,345	Y160H	probably damaging	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adgre1	T	A	17: 57,401,912	N34K	possibly damaging	Het
Ago2	T	A	15: 73,146,411	E59D	probably benign	Het
Akap8l	G	T	17: 32,334,631	Q372K	probably benign	Het
Aox2	A	G	1: 58,349,130		probably null	Het
Apc2	T	C	10: 80,309,109	V618A	probably benign	Het
Cacna1d	A	T	14: 30,042,090	C2140S	probably damaging	Het
Capn9	C	T	8: 124,609,159	R529*	probably null	Het
Ccdc180	T	A	4: 45,944,949	N1452K	probably damaging	Het
Cdh5	A	T	8: 104,142,906	I755F	possibly damaging	Het
Cdkal1	T	A	13: 29,354,758	M473L	probably benign	Het
Cfap65	T	C	1: 74,904,025	I1614V	probably damaging	Het
Champ1	A	G	8: 13,880,017	H725R	probably damaging	Het
Cntnap5a	A	T	1: 116,580,639	T1294S	possibly damaging	Het
Cops8	A	C	1: 90,606,619	N94T	probably benign	Het
Cpne7	G	T	8: 123,124,438	V155L	probably benign	Het
Dhx29	T	C	13: 112,952,804	V703A	probably damaging	Het
Dhx30	A	G	9: 110,087,635	L575P	probably damaging	Het
Dmc1	T	A	15: 79,585,126	H156L	possibly damaging	Het
Dnmt3a	A	G	12: 3,849,654		probably benign	Het
Dst	C	G	1: 34,170,433	L869V	probably damaging	Het
Eif3d	A	T	15: 77,964,942	M180K	probably benign	Het
Erbb3	T	C	10: 128,569,871	T1173A	probably damaging	Het
Fat4	A	T	3: 39,010,215	K4773N	probably damaging	Het
Fbn2	G	A	18: 58,052,963	P1771L	possibly damaging	Het
Fer1l4	T	G	2: 156,031,764	Y1207S	probably damaging	Het
Fermt2	G	A	14: 45,475,897	T87I	probably benign	Het
Fpr3	T	A	17: 17,971,382	M305K	possibly damaging	Het
Fzd2	A	G	11: 102,605,423	E231G	probably benign	Het
Ggcx	T	C	6: 72,427,982	Y458H	probably benign	Het
Ggt7	A	G	2: 155,495,719	S504P	probably damaging	Het
Gm14548	A	T	7: 3,897,489	N87K	probably benign	Het
Gm4884	A	G	7: 41,043,486	H293R	possibly damaging	Het
Gm5475	A	G	15: 100,424,213		probably benign	Het
Gm5930	A	T	14: 44,336,536	L115M	probably damaging	Het
Itln1	T	A	1: 171,531,547	T122S	probably damaging	Het
Itpr3	T	A	17: 27,115,053	L2033Q	probably benign	Het
Lama2	T	C	10: 27,043,569	D2222G	probably damaging	Het
Lars2	T	C	9: 123,418,780	L334P	probably damaging	Het
Ly9	T	C	1: 171,597,681		probably null	Het
Man1a	T	C	10: 53,977,049	I324M	probably damaging	Het
Mast3	T	C	8: 70,780,963	E994G	probably damaging	Het
Mettl21a	A	T	1: 64,616,283	V46E	probably damaging	Het
Mmp15	A	G	8: 95,370,173	D398G	probably benign	Het
Mybpc1	T	A	10: 88,555,678	D319V	probably damaging	Het
Olfr1154	A	C	2: 87,902,925	Y250*	probably null	Het
Olfr1251	A	T	2: 89,667,867	N6K	possibly damaging	Het
Olfr1256	A	T	2: 89,835,425	D173E	probably damaging	Het
Olfr1260	G	A	2: 89,977,912	V45I	possibly damaging	Het
Olfr1314	A	T	2: 112,092,407	I98N	probably damaging	Het
Olfr1467	T	A	19: 13,365,537	I303N	possibly damaging	Het
Olfr288	T	A	15: 98,186,967	K277*	probably null	Het
Olfr467	G	A	7: 107,815,222	V213I	probably benign	Het
Otogl	C	T	10: 107,856,977	C882Y	probably damaging	Het
Parp10	A	G	15: 76,233,583	Y868H	probably damaging	Het
Pick1	T	A	15: 79,239,699	I90N	probably damaging	Het
Piezo1	C	T	8: 122,491,488	V1170I	probably benign	Het
Pim3	G	A	15: 88,862,912	V54I	possibly damaging	Het
Pinlyp	T	C	7: 24,546,008		probably benign	Het
Ppfia3	G	A	7: 45,354,890	Q473*	probably null	Het
Rab3gap2	G	A	1: 185,275,916	G1056E	probably damaging	Het
Ralgapa2	G	A	2: 146,421,679	T706I	probably benign	Het
Reln	T	C	5: 21,972,047	T1874A	possibly damaging	Het
Rftn1	C	A	17: 50,169,145	M1I	probably null	Het
Ros1	T	A	10: 52,166,079	Q250L	probably damaging	Het
Slc11a1	T	A	1: 74,380,665	F166I	probably damaging	Het
Slc17a9	A	G	2: 180,731,962	T59A	probably benign	Het
Slc26a5	T	C	5: 21,823,478	K364R	probably damaging	Het
Slitrk2	T	C	X: 66,655,148	I415T	probably damaging	Het
Stom	A	G	2: 35,321,601	I136T	possibly damaging	Het
Strc	G	T	2: 121,364,523	P1728T	probably damaging	Het
Telo2	C	A	17: 25,103,699	V640F	probably benign	Het
Tg	T	C	15: 66,681,933	V399A	probably benign	Het
Tmem214	A	G	5: 30,873,631	K383E	possibly damaging	Het
Tomm40l	A	T	1: 171,221,981	L13*	probably null	Het
Tonsl	A	T	15: 76,634,640	N526K	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Tymp	T	A	15: 89,374,762	M240L	probably benign	Het
Ubr2	A	T	17: 46,986,042	S271T	possibly damaging	Het
Uggt2	A	T	14: 119,075,337	N353K	probably damaging	Het
Ugt2b35	T	A	5: 87,003,332	F266I	possibly damaging	Het
Vmn2r103	C	T	17: 19,793,647	R234W	probably damaging	Het
Zfp109	C	A	7: 24,228,461	D508Y	probably damaging	Het
Zfp623	T	C	15: 75,947,530	S112P	possibly damaging	Het
Zfp735	A	G	11: 73,711,025	N265S	possibly damaging	Het
Zfp879	A	G	11: 50,833,267	C321R	probably damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0831:Cadps2	UTSW	6	23321740	missense	possibly damaging	0.88
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGATAATGGCAAAGCACATTC -3'
(R):5'- ACATTTACAGCTGCCCCTGAC -3'

Sequencing Primer
(F):5'- TGATAATGGCAAAGCACATTCTCTCC -3'
(R):5'- AAGTTCCACAGCCGCTCTGAG -3'

Posted On

2014-10-15