Incidental Mutation 'R2219:Mast3'
ID 241335
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 040221-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2219 (G1)
Quality Score 209
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71233607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 994 (E994G)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect possibly damaging
Transcript: ENSMUST00000166004
AA Change: E1010G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: E1010G

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: E994G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000212140
AA Change: E245G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,095,769 (GRCm39) Y160H probably damaging Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adgre1 T A 17: 57,708,912 (GRCm39) N34K possibly damaging Het
Ago2 T A 15: 73,018,260 (GRCm39) E59D probably benign Het
Akap8l G T 17: 32,553,605 (GRCm39) Q372K probably benign Het
Aox1 A G 1: 58,388,289 (GRCm39) probably null Het
Apc2 T C 10: 80,144,943 (GRCm39) V618A probably benign Het
Cacna1d A T 14: 29,764,047 (GRCm39) C2140S probably damaging Het
Cadps2 A G 6: 23,410,831 (GRCm39) L671P probably damaging Het
Capn9 C T 8: 125,335,898 (GRCm39) R529* probably null Het
Ccdc180 T A 4: 45,944,949 (GRCm39) N1452K probably damaging Het
Cdh5 A T 8: 104,869,538 (GRCm39) I755F possibly damaging Het
Cdkal1 T A 13: 29,538,741 (GRCm39) M473L probably benign Het
Cfap65 T C 1: 74,943,184 (GRCm39) I1614V probably damaging Het
Champ1 A G 8: 13,930,017 (GRCm39) H725R probably damaging Het
Cntnap5a A T 1: 116,508,369 (GRCm39) T1294S possibly damaging Het
Cops8 A C 1: 90,534,341 (GRCm39) N94T probably benign Het
Cpne7 G T 8: 123,851,177 (GRCm39) V155L probably benign Het
Dhx29 T C 13: 113,089,338 (GRCm39) V703A probably damaging Het
Dhx30 A G 9: 109,916,703 (GRCm39) L575P probably damaging Het
Dmc1 T A 15: 79,469,327 (GRCm39) H156L possibly damaging Het
Dnmt3a A G 12: 3,899,654 (GRCm39) probably benign Het
Dst C G 1: 34,209,514 (GRCm39) L869V probably damaging Het
Eif3d A T 15: 77,849,142 (GRCm39) M180K probably benign Het
Erbb3 T C 10: 128,405,740 (GRCm39) T1173A probably damaging Het
Fat4 A T 3: 39,064,364 (GRCm39) K4773N probably damaging Het
Fbn2 G A 18: 58,186,035 (GRCm39) P1771L possibly damaging Het
Fer1l4 T G 2: 155,873,684 (GRCm39) Y1207S probably damaging Het
Fermt2 G A 14: 45,713,354 (GRCm39) T87I probably benign Het
Fpr3 T A 17: 18,191,644 (GRCm39) M305K possibly damaging Het
Fzd2 A G 11: 102,496,249 (GRCm39) E231G probably benign Het
Ggcx T C 6: 72,404,965 (GRCm39) Y458H probably benign Het
Ggt7 A G 2: 155,337,639 (GRCm39) S504P probably damaging Het
Gm4884 A G 7: 40,692,910 (GRCm39) H293R possibly damaging Het
Gm5475 A G 15: 100,322,094 (GRCm39) probably benign Het
Gm5930 A T 14: 44,573,993 (GRCm39) L115M probably damaging Het
Itln1 T A 1: 171,359,115 (GRCm39) T122S probably damaging Het
Itpr3 T A 17: 27,334,027 (GRCm39) L2033Q probably benign Het
Lama2 T C 10: 26,919,565 (GRCm39) D2222G probably damaging Het
Lars2 T C 9: 123,247,845 (GRCm39) L334P probably damaging Het
Ly9 T C 1: 171,425,249 (GRCm39) probably null Het
Man1a T C 10: 53,853,145 (GRCm39) I324M probably damaging Het
Mettl21a A T 1: 64,655,442 (GRCm39) V46E probably damaging Het
Mmp15 A G 8: 96,096,801 (GRCm39) D398G probably benign Het
Mybpc1 T A 10: 88,391,540 (GRCm39) D319V probably damaging Het
Or10ad1c T A 15: 98,084,848 (GRCm39) K277* probably null Het
Or4a47 A T 2: 89,665,769 (GRCm39) D173E probably damaging Het
Or4a78 A T 2: 89,498,211 (GRCm39) N6K possibly damaging Het
Or4c35 G A 2: 89,808,256 (GRCm39) V45I possibly damaging Het
Or4f61 A T 2: 111,922,752 (GRCm39) I98N probably damaging Het
Or5b113 T A 19: 13,342,901 (GRCm39) I303N possibly damaging Het
Or5p5 G A 7: 107,414,429 (GRCm39) V213I probably benign Het
Or9m1 A C 2: 87,733,269 (GRCm39) Y250* probably null Het
Otogl C T 10: 107,692,838 (GRCm39) C882Y probably damaging Het
Parp10 A G 15: 76,117,783 (GRCm39) Y868H probably damaging Het
Pick1 T A 15: 79,123,899 (GRCm39) I90N probably damaging Het
Piezo1 C T 8: 123,218,227 (GRCm39) V1170I probably benign Het
Pim3 G A 15: 88,747,115 (GRCm39) V54I possibly damaging Het
Pinlyp T C 7: 24,245,433 (GRCm39) probably benign Het
Pira12 A T 7: 3,900,488 (GRCm39) N87K probably benign Het
Ppfia3 G A 7: 45,004,314 (GRCm39) Q473* probably null Het
Rab3gap2 G A 1: 185,008,113 (GRCm39) G1056E probably damaging Het
Ralgapa2 G A 2: 146,263,599 (GRCm39) T706I probably benign Het
Reln T C 5: 22,177,045 (GRCm39) T1874A possibly damaging Het
Rftn1 C A 17: 50,476,173 (GRCm39) M1I probably null Het
Ros1 T A 10: 52,042,175 (GRCm39) Q250L probably damaging Het
Slc11a1 T A 1: 74,419,824 (GRCm39) F166I probably damaging Het
Slc17a9 A G 2: 180,373,755 (GRCm39) T59A probably benign Het
Slc26a5 T C 5: 22,028,476 (GRCm39) K364R probably damaging Het
Slitrk2 T C X: 65,698,754 (GRCm39) I415T probably damaging Het
Stom A G 2: 35,211,613 (GRCm39) I136T possibly damaging Het
Strc G T 2: 121,195,004 (GRCm39) P1728T probably damaging Het
Telo2 C A 17: 25,322,673 (GRCm39) V640F probably benign Het
Tg T C 15: 66,553,782 (GRCm39) V399A probably benign Het
Tmem214 A G 5: 31,030,975 (GRCm39) K383E possibly damaging Het
Tomm40l A T 1: 171,049,550 (GRCm39) L13* probably null Het
Tonsl A T 15: 76,518,840 (GRCm39) N526K probably damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tymp T A 15: 89,258,965 (GRCm39) M240L probably benign Het
Ubr2 A T 17: 47,296,968 (GRCm39) S271T possibly damaging Het
Uggt2 A T 14: 119,312,749 (GRCm39) N353K probably damaging Het
Ugt2b35 T A 5: 87,151,191 (GRCm39) F266I possibly damaging Het
Vmn2r103 C T 17: 20,013,909 (GRCm39) R234W probably damaging Het
Zfp109 C A 7: 23,927,886 (GRCm39) D508Y probably damaging Het
Zfp623 T C 15: 75,819,379 (GRCm39) S112P possibly damaging Het
Zfp735 A G 11: 73,601,851 (GRCm39) N265S possibly damaging Het
Zfp879 A G 11: 50,724,094 (GRCm39) C321R probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAAAAGGCTCGTGGTGTCAGG -3'
(R):5'- ATGGGTGATAGTGACGTGTACAC -3'

Sequencing Primer
(F):5'- CTCGTGGTGTCAGGGACAG -3'
(R):5'- TCTGGGTGAGTCCTCGACAAAC -3'
Posted On 2014-10-15