Mutagenetix > Incidental Mutation

Incidental Mutation 'R2219:Mast3'

241335

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

040221-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2219 (G1)

Quality Score

209

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70780963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 994 (E994G)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166004
AA Change: E1010G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: E1010G

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: E994G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

unknown
Transcript: ENSMUST00000212140
AA Change: E245G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	A	G	7: 42,446,345	Y160H	probably damaging	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adgre1	T	A	17: 57,401,912	N34K	possibly damaging	Het
Ago2	T	A	15: 73,146,411	E59D	probably benign	Het
Akap8l	G	T	17: 32,334,631	Q372K	probably benign	Het
Aox2	A	G	1: 58,349,130		probably null	Het
Apc2	T	C	10: 80,309,109	V618A	probably benign	Het
Cacna1d	A	T	14: 30,042,090	C2140S	probably damaging	Het
Cadps2	A	G	6: 23,410,832	L671P	probably damaging	Het
Capn9	C	T	8: 124,609,159	R529*	probably null	Het
Ccdc180	T	A	4: 45,944,949	N1452K	probably damaging	Het
Cdh5	A	T	8: 104,142,906	I755F	possibly damaging	Het
Cdkal1	T	A	13: 29,354,758	M473L	probably benign	Het
Cfap65	T	C	1: 74,904,025	I1614V	probably damaging	Het
Champ1	A	G	8: 13,880,017	H725R	probably damaging	Het
Cntnap5a	A	T	1: 116,580,639	T1294S	possibly damaging	Het
Cops8	A	C	1: 90,606,619	N94T	probably benign	Het
Cpne7	G	T	8: 123,124,438	V155L	probably benign	Het
Dhx29	T	C	13: 112,952,804	V703A	probably damaging	Het
Dhx30	A	G	9: 110,087,635	L575P	probably damaging	Het
Dmc1	T	A	15: 79,585,126	H156L	possibly damaging	Het
Dnmt3a	A	G	12: 3,849,654		probably benign	Het
Dst	C	G	1: 34,170,433	L869V	probably damaging	Het
Eif3d	A	T	15: 77,964,942	M180K	probably benign	Het
Erbb3	T	C	10: 128,569,871	T1173A	probably damaging	Het
Fat4	A	T	3: 39,010,215	K4773N	probably damaging	Het
Fbn2	G	A	18: 58,052,963	P1771L	possibly damaging	Het
Fer1l4	T	G	2: 156,031,764	Y1207S	probably damaging	Het
Fermt2	G	A	14: 45,475,897	T87I	probably benign	Het
Fpr3	T	A	17: 17,971,382	M305K	possibly damaging	Het
Fzd2	A	G	11: 102,605,423	E231G	probably benign	Het
Ggcx	T	C	6: 72,427,982	Y458H	probably benign	Het
Ggt7	A	G	2: 155,495,719	S504P	probably damaging	Het
Gm14548	A	T	7: 3,897,489	N87K	probably benign	Het
Gm4884	A	G	7: 41,043,486	H293R	possibly damaging	Het
Gm5475	A	G	15: 100,424,213		probably benign	Het
Gm5930	A	T	14: 44,336,536	L115M	probably damaging	Het
Itln1	T	A	1: 171,531,547	T122S	probably damaging	Het
Itpr3	T	A	17: 27,115,053	L2033Q	probably benign	Het
Lama2	T	C	10: 27,043,569	D2222G	probably damaging	Het
Lars2	T	C	9: 123,418,780	L334P	probably damaging	Het
Ly9	T	C	1: 171,597,681		probably null	Het
Man1a	T	C	10: 53,977,049	I324M	probably damaging	Het
Mettl21a	A	T	1: 64,616,283	V46E	probably damaging	Het
Mmp15	A	G	8: 95,370,173	D398G	probably benign	Het
Mybpc1	T	A	10: 88,555,678	D319V	probably damaging	Het
Olfr1154	A	C	2: 87,902,925	Y250*	probably null	Het
Olfr1251	A	T	2: 89,667,867	N6K	possibly damaging	Het
Olfr1256	A	T	2: 89,835,425	D173E	probably damaging	Het
Olfr1260	G	A	2: 89,977,912	V45I	possibly damaging	Het
Olfr1314	A	T	2: 112,092,407	I98N	probably damaging	Het
Olfr1467	T	A	19: 13,365,537	I303N	possibly damaging	Het
Olfr288	T	A	15: 98,186,967	K277*	probably null	Het
Olfr467	G	A	7: 107,815,222	V213I	probably benign	Het
Otogl	C	T	10: 107,856,977	C882Y	probably damaging	Het
Parp10	A	G	15: 76,233,583	Y868H	probably damaging	Het
Pick1	T	A	15: 79,239,699	I90N	probably damaging	Het
Piezo1	C	T	8: 122,491,488	V1170I	probably benign	Het
Pim3	G	A	15: 88,862,912	V54I	possibly damaging	Het
Pinlyp	T	C	7: 24,546,008		probably benign	Het
Ppfia3	G	A	7: 45,354,890	Q473*	probably null	Het
Rab3gap2	G	A	1: 185,275,916	G1056E	probably damaging	Het
Ralgapa2	G	A	2: 146,421,679	T706I	probably benign	Het
Reln	T	C	5: 21,972,047	T1874A	possibly damaging	Het
Rftn1	C	A	17: 50,169,145	M1I	probably null	Het
Ros1	T	A	10: 52,166,079	Q250L	probably damaging	Het
Slc11a1	T	A	1: 74,380,665	F166I	probably damaging	Het
Slc17a9	A	G	2: 180,731,962	T59A	probably benign	Het
Slc26a5	T	C	5: 21,823,478	K364R	probably damaging	Het
Slitrk2	T	C	X: 66,655,148	I415T	probably damaging	Het
Stom	A	G	2: 35,321,601	I136T	possibly damaging	Het
Strc	G	T	2: 121,364,523	P1728T	probably damaging	Het
Telo2	C	A	17: 25,103,699	V640F	probably benign	Het
Tg	T	C	15: 66,681,933	V399A	probably benign	Het
Tmem214	A	G	5: 30,873,631	K383E	possibly damaging	Het
Tomm40l	A	T	1: 171,221,981	L13*	probably null	Het
Tonsl	A	T	15: 76,634,640	N526K	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Tymp	T	A	15: 89,374,762	M240L	probably benign	Het
Ubr2	A	T	17: 46,986,042	S271T	possibly damaging	Het
Uggt2	A	T	14: 119,075,337	N353K	probably damaging	Het
Ugt2b35	T	A	5: 87,003,332	F266I	possibly damaging	Het
Vmn2r103	C	T	17: 19,793,647	R234W	probably damaging	Het
Zfp109	C	A	7: 24,228,461	D508Y	probably damaging	Het
Zfp623	T	C	15: 75,947,530	S112P	possibly damaging	Het
Zfp735	A	G	11: 73,711,025	N265S	possibly damaging	Het
Zfp879	A	G	11: 50,833,267	C321R	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAAAAGGCTCGTGGTGTCAGG -3'
(R):5'- ATGGGTGATAGTGACGTGTACAC -3'

Sequencing Primer
(F):5'- CTCGTGGTGTCAGGGACAG -3'
(R):5'- TCTGGGTGAGTCCTCGACAAAC -3'

Posted On

2014-10-15