Incidental Mutation 'R2219:Cdh5'
ID241337
Institutional Source Beutler Lab
Gene Symbol Cdh5
Ensembl Gene ENSMUSG00000031871
Gene Namecadherin 5
SynonymsVECD, VEcad, VE-cadherin, CD144, VE-Cad, 7B4/cadherin-5, VEC
MMRRC Submission 040221-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2219 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104101625-104144511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104142906 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 755 (I755F)
Ref Sequence ENSEMBL: ENSMUSP00000034339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034339]
PDB Structure
NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034339
AA Change: I755F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034339
Gene: ENSMUSG00000031871
AA Change: I755F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 66 147 3.03e-10 SMART
CA 171 254 3.19e-18 SMART
CA 278 370 7.92e-14 SMART
CA 392 476 1.09e-16 SMART
CA 499 583 2.16e-6 SMART
transmembrane domain 598 620 N/A INTRINSIC
Pfam:Cadherin_C 625 776 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein die in utero due to vascular insufficiency, caused by increased endothelial apoptosis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous inactivation or cytosolic truncation of this gene causes embryonic growth retardation, abnormal somite and heart development, impaired remodeling and maturation of endothelial cells, increased endothelial apoptosis and severe vascular defects leading to embryonic death at midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,446,345 Y160H probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre1 T A 17: 57,401,912 N34K possibly damaging Het
Ago2 T A 15: 73,146,411 E59D probably benign Het
Akap8l G T 17: 32,334,631 Q372K probably benign Het
Aox2 A G 1: 58,349,130 probably null Het
Apc2 T C 10: 80,309,109 V618A probably benign Het
Cacna1d A T 14: 30,042,090 C2140S probably damaging Het
Cadps2 A G 6: 23,410,832 L671P probably damaging Het
Capn9 C T 8: 124,609,159 R529* probably null Het
Ccdc180 T A 4: 45,944,949 N1452K probably damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Champ1 A G 8: 13,880,017 H725R probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Cpne7 G T 8: 123,124,438 V155L probably benign Het
Dhx29 T C 13: 112,952,804 V703A probably damaging Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dmc1 T A 15: 79,585,126 H156L possibly damaging Het
Dnmt3a A G 12: 3,849,654 probably benign Het
Dst C G 1: 34,170,433 L869V probably damaging Het
Eif3d A T 15: 77,964,942 M180K probably benign Het
Erbb3 T C 10: 128,569,871 T1173A probably damaging Het
Fat4 A T 3: 39,010,215 K4773N probably damaging Het
Fbn2 G A 18: 58,052,963 P1771L possibly damaging Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Fermt2 G A 14: 45,475,897 T87I probably benign Het
Fpr3 T A 17: 17,971,382 M305K possibly damaging Het
Fzd2 A G 11: 102,605,423 E231G probably benign Het
Ggcx T C 6: 72,427,982 Y458H probably benign Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Gm5475 A G 15: 100,424,213 probably benign Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Itln1 T A 1: 171,531,547 T122S probably damaging Het
Itpr3 T A 17: 27,115,053 L2033Q probably benign Het
Lama2 T C 10: 27,043,569 D2222G probably damaging Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Ly9 T C 1: 171,597,681 probably null Het
Man1a T C 10: 53,977,049 I324M probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Mmp15 A G 8: 95,370,173 D398G probably benign Het
Mybpc1 T A 10: 88,555,678 D319V probably damaging Het
Olfr1154 A C 2: 87,902,925 Y250* probably null Het
Olfr1251 A T 2: 89,667,867 N6K possibly damaging Het
Olfr1256 A T 2: 89,835,425 D173E probably damaging Het
Olfr1260 G A 2: 89,977,912 V45I possibly damaging Het
Olfr1314 A T 2: 112,092,407 I98N probably damaging Het
Olfr1467 T A 19: 13,365,537 I303N possibly damaging Het
Olfr288 T A 15: 98,186,967 K277* probably null Het
Olfr467 G A 7: 107,815,222 V213I probably benign Het
Otogl C T 10: 107,856,977 C882Y probably damaging Het
Parp10 A G 15: 76,233,583 Y868H probably damaging Het
Pick1 T A 15: 79,239,699 I90N probably damaging Het
Piezo1 C T 8: 122,491,488 V1170I probably benign Het
Pim3 G A 15: 88,862,912 V54I possibly damaging Het
Pinlyp T C 7: 24,546,008 probably benign Het
Ppfia3 G A 7: 45,354,890 Q473* probably null Het
Rab3gap2 G A 1: 185,275,916 G1056E probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Reln T C 5: 21,972,047 T1874A possibly damaging Het
Rftn1 C A 17: 50,169,145 M1I probably null Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc17a9 A G 2: 180,731,962 T59A probably benign Het
Slc26a5 T C 5: 21,823,478 K364R probably damaging Het
Slitrk2 T C X: 66,655,148 I415T probably damaging Het
Stom A G 2: 35,321,601 I136T possibly damaging Het
Strc G T 2: 121,364,523 P1728T probably damaging Het
Telo2 C A 17: 25,103,699 V640F probably benign Het
Tg T C 15: 66,681,933 V399A probably benign Het
Tmem214 A G 5: 30,873,631 K383E possibly damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Tonsl A T 15: 76,634,640 N526K probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tymp T A 15: 89,374,762 M240L probably benign Het
Ubr2 A T 17: 46,986,042 S271T possibly damaging Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Ugt2b35 T A 5: 87,003,332 F266I possibly damaging Het
Vmn2r103 C T 17: 19,793,647 R234W probably damaging Het
Zfp109 C A 7: 24,228,461 D508Y probably damaging Het
Zfp623 T C 15: 75,947,530 S112P possibly damaging Het
Zfp735 A G 11: 73,711,025 N265S possibly damaging Het
Zfp879 A G 11: 50,833,267 C321R probably damaging Het
Other mutations in Cdh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Cdh5 APN 8 104137817 missense probably damaging 1.00
IGL02506:Cdh5 APN 8 104137822 missense probably damaging 1.00
IGL02737:Cdh5 APN 8 104142928 missense probably damaging 1.00
IGL03287:Cdh5 APN 8 104128115 missense probably damaging 1.00
IGL03297:Cdh5 APN 8 104128199 missense probably damaging 1.00
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0126:Cdh5 UTSW 8 104140682 critical splice acceptor site probably null
R0167:Cdh5 UTSW 8 104136735 missense possibly damaging 0.51
R0592:Cdh5 UTSW 8 104130902 splice site probably null
R1760:Cdh5 UTSW 8 104128169 missense probably benign
R1826:Cdh5 UTSW 8 104131091 missense possibly damaging 0.93
R1827:Cdh5 UTSW 8 104112909 missense possibly damaging 0.96
R1840:Cdh5 UTSW 8 104126616 nonsense probably null
R1993:Cdh5 UTSW 8 104137815 missense probably damaging 0.97
R2239:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R2281:Cdh5 UTSW 8 104125733 missense probably damaging 1.00
R2380:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R3418:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3419:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3429:Cdh5 UTSW 8 104130968 missense possibly damaging 0.91
R4491:Cdh5 UTSW 8 104113040 missense probably damaging 1.00
R4823:Cdh5 UTSW 8 104142669 missense probably benign 0.00
R5071:Cdh5 UTSW 8 104140702 missense probably damaging 0.99
R5265:Cdh5 UTSW 8 104142739 missense probably benign 0.00
R5383:Cdh5 UTSW 8 104137847 missense probably benign 0.17
R5447:Cdh5 UTSW 8 104129362 missense probably damaging 0.99
R5580:Cdh5 UTSW 8 104125494 nonsense probably null
R5876:Cdh5 UTSW 8 104142577 missense probably damaging 1.00
R5934:Cdh5 UTSW 8 104138268 missense probably benign 0.00
R6378:Cdh5 UTSW 8 104126536 splice site probably null
R7110:Cdh5 UTSW 8 104140768 missense probably damaging 1.00
R7141:Cdh5 UTSW 8 104113001 missense probably benign 0.20
R7324:Cdh5 UTSW 8 104142793 missense probably damaging 1.00
R7658:Cdh5 UTSW 8 104129401 critical splice donor site probably null
X0067:Cdh5 UTSW 8 104142537 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTGCTTAATTCTGTGCGCG -3'
(R):5'- TCCTTGGAAATCAGGGAAGAC -3'

Sequencing Primer
(F):5'- GGCAGTGTACACGCAGG -3'
(R):5'- ACAGTGTCCGGTGTCTGATCC -3'
Posted On2014-10-15