Incidental Mutation 'R2219:Ros1'
ID241344
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 040221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2219 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52166079 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 250 (Q250L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably damaging
Transcript: ENSMUST00000020045
AA Change: Q259L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: Q259L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117992
AA Change: Q259L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: Q259L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175892
AA Change: Q250L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135235
Gene: ENSMUSG00000019893
AA Change: Q250L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 100 178 1.05e-4 SMART
FN3 196 273 7.45e-10 SMART
Blast:LY 360 400 1e-20 BLAST
Blast:LY 449 486 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177378
AA Change: Q259L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: Q259L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218452
AA Change: Q259L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219173
AA Change: Q259L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000219692
AA Change: Q250L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,446,345 Y160H probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre1 T A 17: 57,401,912 N34K possibly damaging Het
Ago2 T A 15: 73,146,411 E59D probably benign Het
Akap8l G T 17: 32,334,631 Q372K probably benign Het
Aox2 A G 1: 58,349,130 probably null Het
Apc2 T C 10: 80,309,109 V618A probably benign Het
Cacna1d A T 14: 30,042,090 C2140S probably damaging Het
Cadps2 A G 6: 23,410,832 L671P probably damaging Het
Capn9 C T 8: 124,609,159 R529* probably null Het
Ccdc180 T A 4: 45,944,949 N1452K probably damaging Het
Cdh5 A T 8: 104,142,906 I755F possibly damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Champ1 A G 8: 13,880,017 H725R probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Cpne7 G T 8: 123,124,438 V155L probably benign Het
Dhx29 T C 13: 112,952,804 V703A probably damaging Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dmc1 T A 15: 79,585,126 H156L possibly damaging Het
Dnmt3a A G 12: 3,849,654 probably benign Het
Dst C G 1: 34,170,433 L869V probably damaging Het
Eif3d A T 15: 77,964,942 M180K probably benign Het
Erbb3 T C 10: 128,569,871 T1173A probably damaging Het
Fat4 A T 3: 39,010,215 K4773N probably damaging Het
Fbn2 G A 18: 58,052,963 P1771L possibly damaging Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Fermt2 G A 14: 45,475,897 T87I probably benign Het
Fpr3 T A 17: 17,971,382 M305K possibly damaging Het
Fzd2 A G 11: 102,605,423 E231G probably benign Het
Ggcx T C 6: 72,427,982 Y458H probably benign Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Gm5475 A G 15: 100,424,213 probably benign Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Itln1 T A 1: 171,531,547 T122S probably damaging Het
Itpr3 T A 17: 27,115,053 L2033Q probably benign Het
Lama2 T C 10: 27,043,569 D2222G probably damaging Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Ly9 T C 1: 171,597,681 probably null Het
Man1a T C 10: 53,977,049 I324M probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Mmp15 A G 8: 95,370,173 D398G probably benign Het
Mybpc1 T A 10: 88,555,678 D319V probably damaging Het
Olfr1154 A C 2: 87,902,925 Y250* probably null Het
Olfr1251 A T 2: 89,667,867 N6K possibly damaging Het
Olfr1256 A T 2: 89,835,425 D173E probably damaging Het
Olfr1260 G A 2: 89,977,912 V45I possibly damaging Het
Olfr1314 A T 2: 112,092,407 I98N probably damaging Het
Olfr1467 T A 19: 13,365,537 I303N possibly damaging Het
Olfr288 T A 15: 98,186,967 K277* probably null Het
Olfr467 G A 7: 107,815,222 V213I probably benign Het
Otogl C T 10: 107,856,977 C882Y probably damaging Het
Parp10 A G 15: 76,233,583 Y868H probably damaging Het
Pick1 T A 15: 79,239,699 I90N probably damaging Het
Piezo1 C T 8: 122,491,488 V1170I probably benign Het
Pim3 G A 15: 88,862,912 V54I possibly damaging Het
Pinlyp T C 7: 24,546,008 probably benign Het
Ppfia3 G A 7: 45,354,890 Q473* probably null Het
Rab3gap2 G A 1: 185,275,916 G1056E probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Reln T C 5: 21,972,047 T1874A possibly damaging Het
Rftn1 C A 17: 50,169,145 M1I probably null Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc17a9 A G 2: 180,731,962 T59A probably benign Het
Slc26a5 T C 5: 21,823,478 K364R probably damaging Het
Slitrk2 T C X: 66,655,148 I415T probably damaging Het
Stom A G 2: 35,321,601 I136T possibly damaging Het
Strc G T 2: 121,364,523 P1728T probably damaging Het
Telo2 C A 17: 25,103,699 V640F probably benign Het
Tg T C 15: 66,681,933 V399A probably benign Het
Tmem214 A G 5: 30,873,631 K383E possibly damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Tonsl A T 15: 76,634,640 N526K probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tymp T A 15: 89,374,762 M240L probably benign Het
Ubr2 A T 17: 46,986,042 S271T possibly damaging Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Ugt2b35 T A 5: 87,003,332 F266I possibly damaging Het
Vmn2r103 C T 17: 19,793,647 R234W probably damaging Het
Zfp109 C A 7: 24,228,461 D508Y probably damaging Het
Zfp623 T C 15: 75,947,530 S112P possibly damaging Het
Zfp735 A G 11: 73,711,025 N265S possibly damaging Het
Zfp879 A G 11: 50,833,267 C321R probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
boss UTSW 10 52090995 nonsense probably null
Chuckwagon UTSW 10 52118203 missense probably damaging 1.00
trail UTSW 10 52161895 nonsense probably null
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 splice site probably null
R3424:Ros1 UTSW 10 52128416 splice site probably null
R3425:Ros1 UTSW 10 52128416 splice site probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
R7355:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R7385:Ros1 UTSW 10 52155126 missense probably benign 0.00
R7460:Ros1 UTSW 10 52118203 missense probably damaging 1.00
R7549:Ros1 UTSW 10 52145834 missense probably damaging 0.96
R7573:Ros1 UTSW 10 52169976 missense probably benign 0.03
R7650:Ros1 UTSW 10 52046209 missense probably benign 0.00
R7667:Ros1 UTSW 10 52163971 missense probably damaging 1.00
R7696:Ros1 UTSW 10 52142283 missense probably damaging 1.00
R7785:Ros1 UTSW 10 52162848 missense probably damaging 1.00
R7814:Ros1 UTSW 10 52096137 missense probably benign 0.28
R7830:Ros1 UTSW 10 52154934 missense probably damaging 0.99
R7832:Ros1 UTSW 10 52144861 missense probably damaging 0.99
R7854:Ros1 UTSW 10 52128467 missense probably damaging 1.00
R7912:Ros1 UTSW 10 52168695 missense probably damaging 1.00
R7972:Ros1 UTSW 10 52154830 nonsense probably null
R7993:Ros1 UTSW 10 52123347 missense probably benign 0.34
R8036:Ros1 UTSW 10 52165343 missense probably benign
R8137:Ros1 UTSW 10 52125837 missense possibly damaging 0.87
R8169:Ros1 UTSW 10 52064672 critical splice donor site probably null
R8199:Ros1 UTSW 10 52101717 nonsense probably null
R8293:Ros1 UTSW 10 52087918 missense probably damaging 1.00
R8368:Ros1 UTSW 10 52064737 missense probably damaging 1.00
R8406:Ros1 UTSW 10 52101845 missense possibly damaging 0.56
RF018:Ros1 UTSW 10 52155121 missense probably benign
Z1176:Ros1 UTSW 10 52091109 missense possibly damaging 0.89
Z1177:Ros1 UTSW 10 52168671 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACTAACAGGATTTTACCTCC -3'
(R):5'- AGTTCCAGAAACTGCACCTC -3'

Sequencing Primer
(F):5'- TCTGCTTAGAATTGTGTGATCTAAC -3'
(R):5'- TCTCATCCTGAACATGGAAAGCTGG -3'
Posted On2014-10-15