Incidental Mutation 'R2219:Apc2'
ID241346
Institutional Source Beutler Lab
Gene Symbol Apc2
Ensembl Gene ENSMUSG00000020135
Gene Nameadenomatosis polyposis coli 2
SynonymsAPCL
MMRRC Submission 040221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2219 (G1)
Quality Score200
Status Not validated
Chromosome10
Chromosomal Location80295977-80318263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80309109 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 618 (V618A)
Ref Sequence ENSEMBL: ENSMUSP00000100996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020349] [ENSMUST00000105359]
Predicted Effect probably benign
Transcript: ENSMUST00000020349
AA Change: V589A

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: V589A

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105359
AA Change: V618A

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: V618A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,446,345 Y160H probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre1 T A 17: 57,401,912 N34K possibly damaging Het
Ago2 T A 15: 73,146,411 E59D probably benign Het
Akap8l G T 17: 32,334,631 Q372K probably benign Het
Aox2 A G 1: 58,349,130 probably null Het
Cacna1d A T 14: 30,042,090 C2140S probably damaging Het
Cadps2 A G 6: 23,410,832 L671P probably damaging Het
Capn9 C T 8: 124,609,159 R529* probably null Het
Ccdc180 T A 4: 45,944,949 N1452K probably damaging Het
Cdh5 A T 8: 104,142,906 I755F possibly damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Champ1 A G 8: 13,880,017 H725R probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Cpne7 G T 8: 123,124,438 V155L probably benign Het
Dhx29 T C 13: 112,952,804 V703A probably damaging Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dmc1 T A 15: 79,585,126 H156L possibly damaging Het
Dnmt3a A G 12: 3,849,654 probably benign Het
Dst C G 1: 34,170,433 L869V probably damaging Het
Eif3d A T 15: 77,964,942 M180K probably benign Het
Erbb3 T C 10: 128,569,871 T1173A probably damaging Het
Fat4 A T 3: 39,010,215 K4773N probably damaging Het
Fbn2 G A 18: 58,052,963 P1771L possibly damaging Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Fermt2 G A 14: 45,475,897 T87I probably benign Het
Fpr3 T A 17: 17,971,382 M305K possibly damaging Het
Fzd2 A G 11: 102,605,423 E231G probably benign Het
Ggcx T C 6: 72,427,982 Y458H probably benign Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Gm5475 A G 15: 100,424,213 probably benign Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Itln1 T A 1: 171,531,547 T122S probably damaging Het
Itpr3 T A 17: 27,115,053 L2033Q probably benign Het
Lama2 T C 10: 27,043,569 D2222G probably damaging Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Ly9 T C 1: 171,597,681 probably null Het
Man1a T C 10: 53,977,049 I324M probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Mmp15 A G 8: 95,370,173 D398G probably benign Het
Mybpc1 T A 10: 88,555,678 D319V probably damaging Het
Olfr1154 A C 2: 87,902,925 Y250* probably null Het
Olfr1251 A T 2: 89,667,867 N6K possibly damaging Het
Olfr1256 A T 2: 89,835,425 D173E probably damaging Het
Olfr1260 G A 2: 89,977,912 V45I possibly damaging Het
Olfr1314 A T 2: 112,092,407 I98N probably damaging Het
Olfr1467 T A 19: 13,365,537 I303N possibly damaging Het
Olfr288 T A 15: 98,186,967 K277* probably null Het
Olfr467 G A 7: 107,815,222 V213I probably benign Het
Otogl C T 10: 107,856,977 C882Y probably damaging Het
Parp10 A G 15: 76,233,583 Y868H probably damaging Het
Pick1 T A 15: 79,239,699 I90N probably damaging Het
Piezo1 C T 8: 122,491,488 V1170I probably benign Het
Pim3 G A 15: 88,862,912 V54I possibly damaging Het
Pinlyp T C 7: 24,546,008 probably benign Het
Ppfia3 G A 7: 45,354,890 Q473* probably null Het
Rab3gap2 G A 1: 185,275,916 G1056E probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Reln T C 5: 21,972,047 T1874A possibly damaging Het
Rftn1 C A 17: 50,169,145 M1I probably null Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc17a9 A G 2: 180,731,962 T59A probably benign Het
Slc26a5 T C 5: 21,823,478 K364R probably damaging Het
Slitrk2 T C X: 66,655,148 I415T probably damaging Het
Stom A G 2: 35,321,601 I136T possibly damaging Het
Strc G T 2: 121,364,523 P1728T probably damaging Het
Telo2 C A 17: 25,103,699 V640F probably benign Het
Tg T C 15: 66,681,933 V399A probably benign Het
Tmem214 A G 5: 30,873,631 K383E possibly damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Tonsl A T 15: 76,634,640 N526K probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tymp T A 15: 89,374,762 M240L probably benign Het
Ubr2 A T 17: 46,986,042 S271T possibly damaging Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Ugt2b35 T A 5: 87,003,332 F266I possibly damaging Het
Vmn2r103 C T 17: 19,793,647 R234W probably damaging Het
Zfp109 C A 7: 24,228,461 D508Y probably damaging Het
Zfp623 T C 15: 75,947,530 S112P possibly damaging Het
Zfp735 A G 11: 73,711,025 N265S possibly damaging Het
Zfp879 A G 11: 50,833,267 C321R probably damaging Het
Other mutations in Apc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Apc2 APN 10 80311986 missense probably damaging 1.00
IGL01154:Apc2 APN 10 80313069 missense possibly damaging 0.90
IGL01411:Apc2 APN 10 80315078 missense probably damaging 0.99
IGL01598:Apc2 APN 10 80313048 missense probably damaging 1.00
IGL01621:Apc2 APN 10 80306201 missense probably damaging 1.00
IGL01720:Apc2 APN 10 80314499 missense probably benign 0.01
IGL01837:Apc2 APN 10 80314658 missense probably benign 0.24
IGL01933:Apc2 APN 10 80311740 missense probably damaging 1.00
IGL02243:Apc2 APN 10 80302341 missense probably damaging 1.00
IGL02292:Apc2 APN 10 80302424 missense possibly damaging 0.59
IGL02956:Apc2 APN 10 80306375 missense probably damaging 1.00
IGL03081:Apc2 APN 10 80312252 missense probably damaging 1.00
IGL03172:Apc2 APN 10 80313386 missense probably damaging 0.98
LCD18:Apc2 UTSW 10 80299974 intron probably benign
R0278:Apc2 UTSW 10 80312813 missense possibly damaging 0.90
R0501:Apc2 UTSW 10 80315124 missense probably damaging 1.00
R0594:Apc2 UTSW 10 80306256 nonsense probably null
R0607:Apc2 UTSW 10 80314101 missense probably benign
R0624:Apc2 UTSW 10 80314583 missense probably benign 0.00
R0633:Apc2 UTSW 10 80307455 missense probably damaging 0.99
R0638:Apc2 UTSW 10 80304967 missense probably damaging 0.99
R0647:Apc2 UTSW 10 80304928 missense probably damaging 1.00
R0830:Apc2 UTSW 10 80315405 missense probably damaging 1.00
R1071:Apc2 UTSW 10 80311502 missense probably damaging 1.00
R1221:Apc2 UTSW 10 80306380 missense probably damaging 1.00
R1432:Apc2 UTSW 10 80312349 missense probably benign 0.00
R1579:Apc2 UTSW 10 80311345 missense probably damaging 1.00
R1654:Apc2 UTSW 10 80301842 missense possibly damaging 0.75
R1700:Apc2 UTSW 10 80312769 missense probably damaging 1.00
R1774:Apc2 UTSW 10 80309130 missense probably damaging 1.00
R1864:Apc2 UTSW 10 80313648 missense probably damaging 1.00
R1908:Apc2 UTSW 10 80314844 missense probably benign 0.05
R1915:Apc2 UTSW 10 80315867 missense probably benign
R1999:Apc2 UTSW 10 80309160 missense probably damaging 1.00
R2050:Apc2 UTSW 10 80307609 intron probably null
R2393:Apc2 UTSW 10 80313069 missense possibly damaging 0.90
R3862:Apc2 UTSW 10 80307559 missense possibly damaging 0.82
R3900:Apc2 UTSW 10 80295972 unclassified probably null
R3901:Apc2 UTSW 10 80315088 missense possibly damaging 0.94
R3952:Apc2 UTSW 10 80314484 missense probably damaging 1.00
R4009:Apc2 UTSW 10 80313592 missense probably benign 0.00
R4090:Apc2 UTSW 10 80305544 missense probably damaging 0.97
R4695:Apc2 UTSW 10 80311043 missense probably damaging 1.00
R4754:Apc2 UTSW 10 80314358 missense probably benign 0.01
R4807:Apc2 UTSW 10 80314362 missense probably benign 0.13
R4886:Apc2 UTSW 10 80314213 missense probably damaging 1.00
R4964:Apc2 UTSW 10 80314007 missense probably benign 0.14
R5056:Apc2 UTSW 10 80301314 missense probably benign
R5057:Apc2 UTSW 10 80309069 missense probably damaging 0.99
R5165:Apc2 UTSW 10 80315850 missense probably damaging 0.99
R5241:Apc2 UTSW 10 80312234 missense probably benign
R5649:Apc2 UTSW 10 80314138 missense probably damaging 1.00
R5924:Apc2 UTSW 10 80312150 missense probably damaging 1.00
R6124:Apc2 UTSW 10 80306351 missense probably damaging 0.98
R6218:Apc2 UTSW 10 80306420 missense probably damaging 0.98
R6376:Apc2 UTSW 10 80312654 missense probably damaging 1.00
R6490:Apc2 UTSW 10 80313923 missense probably benign 0.01
R6572:Apc2 UTSW 10 80311779 missense probably damaging 1.00
R6620:Apc2 UTSW 10 80313567 missense probably damaging 0.97
R7171:Apc2 UTSW 10 80315336 missense possibly damaging 0.65
R7180:Apc2 UTSW 10 80311156 missense possibly damaging 0.94
R7326:Apc2 UTSW 10 80311740 missense probably damaging 1.00
R7340:Apc2 UTSW 10 80313482 missense probably benign 0.12
R7378:Apc2 UTSW 10 80311394 missense probably damaging 1.00
R7384:Apc2 UTSW 10 80312624 missense probably damaging 1.00
R7431:Apc2 UTSW 10 80302183 missense possibly damaging 0.83
R7543:Apc2 UTSW 10 80314886 missense possibly damaging 0.72
X0018:Apc2 UTSW 10 80312264 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAATCTTTTGGCCGGAGTGG -3'
(R):5'- ATGGACAGTTACTGAGACACAC -3'

Sequencing Primer
(F):5'- GTGGCTACACCCCTCATG -3'
(R):5'- TACCTGGCCTTGAGGAAAGATCTC -3'
Posted On2014-10-15