Incidental Mutation 'R2219:Uggt2'
ID241365
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene NameUDP-glucose glycoprotein glucosyltransferase 2
Synonyms3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik
MMRRC Submission 040221-MU
Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2219 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location118985039-119099430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119075337 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 353 (N353K)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156203]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136924
Predicted Effect probably damaging
Transcript: ENSMUST00000156203
AA Change: N353K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: N353K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,446,345 Y160H probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre1 T A 17: 57,401,912 N34K possibly damaging Het
Ago2 T A 15: 73,146,411 E59D probably benign Het
Akap8l G T 17: 32,334,631 Q372K probably benign Het
Aox2 A G 1: 58,349,130 probably null Het
Apc2 T C 10: 80,309,109 V618A probably benign Het
Cacna1d A T 14: 30,042,090 C2140S probably damaging Het
Cadps2 A G 6: 23,410,832 L671P probably damaging Het
Capn9 C T 8: 124,609,159 R529* probably null Het
Ccdc180 T A 4: 45,944,949 N1452K probably damaging Het
Cdh5 A T 8: 104,142,906 I755F possibly damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Champ1 A G 8: 13,880,017 H725R probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Cpne7 G T 8: 123,124,438 V155L probably benign Het
Dhx29 T C 13: 112,952,804 V703A probably damaging Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dmc1 T A 15: 79,585,126 H156L possibly damaging Het
Dnmt3a A G 12: 3,849,654 probably benign Het
Dst C G 1: 34,170,433 L869V probably damaging Het
Eif3d A T 15: 77,964,942 M180K probably benign Het
Erbb3 T C 10: 128,569,871 T1173A probably damaging Het
Fat4 A T 3: 39,010,215 K4773N probably damaging Het
Fbn2 G A 18: 58,052,963 P1771L possibly damaging Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Fermt2 G A 14: 45,475,897 T87I probably benign Het
Fpr3 T A 17: 17,971,382 M305K possibly damaging Het
Fzd2 A G 11: 102,605,423 E231G probably benign Het
Ggcx T C 6: 72,427,982 Y458H probably benign Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Gm5475 A G 15: 100,424,213 probably benign Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Itln1 T A 1: 171,531,547 T122S probably damaging Het
Itpr3 T A 17: 27,115,053 L2033Q probably benign Het
Lama2 T C 10: 27,043,569 D2222G probably damaging Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Ly9 T C 1: 171,597,681 probably null Het
Man1a T C 10: 53,977,049 I324M probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Mmp15 A G 8: 95,370,173 D398G probably benign Het
Mybpc1 T A 10: 88,555,678 D319V probably damaging Het
Olfr1154 A C 2: 87,902,925 Y250* probably null Het
Olfr1251 A T 2: 89,667,867 N6K possibly damaging Het
Olfr1256 A T 2: 89,835,425 D173E probably damaging Het
Olfr1260 G A 2: 89,977,912 V45I possibly damaging Het
Olfr1314 A T 2: 112,092,407 I98N probably damaging Het
Olfr1467 T A 19: 13,365,537 I303N possibly damaging Het
Olfr288 T A 15: 98,186,967 K277* probably null Het
Olfr467 G A 7: 107,815,222 V213I probably benign Het
Otogl C T 10: 107,856,977 C882Y probably damaging Het
Parp10 A G 15: 76,233,583 Y868H probably damaging Het
Pick1 T A 15: 79,239,699 I90N probably damaging Het
Piezo1 C T 8: 122,491,488 V1170I probably benign Het
Pim3 G A 15: 88,862,912 V54I possibly damaging Het
Pinlyp T C 7: 24,546,008 probably benign Het
Ppfia3 G A 7: 45,354,890 Q473* probably null Het
Rab3gap2 G A 1: 185,275,916 G1056E probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Reln T C 5: 21,972,047 T1874A possibly damaging Het
Rftn1 C A 17: 50,169,145 M1I probably null Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc17a9 A G 2: 180,731,962 T59A probably benign Het
Slc26a5 T C 5: 21,823,478 K364R probably damaging Het
Slitrk2 T C X: 66,655,148 I415T probably damaging Het
Stom A G 2: 35,321,601 I136T possibly damaging Het
Strc G T 2: 121,364,523 P1728T probably damaging Het
Telo2 C A 17: 25,103,699 V640F probably benign Het
Tg T C 15: 66,681,933 V399A probably benign Het
Tmem214 A G 5: 30,873,631 K383E possibly damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Tonsl A T 15: 76,634,640 N526K probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tymp T A 15: 89,374,762 M240L probably benign Het
Ubr2 A T 17: 46,986,042 S271T possibly damaging Het
Ugt2b35 T A 5: 87,003,332 F266I possibly damaging Het
Vmn2r103 C T 17: 19,793,647 R234W probably damaging Het
Zfp109 C A 7: 24,228,461 D508Y probably damaging Het
Zfp623 T C 15: 75,947,530 S112P possibly damaging Het
Zfp735 A G 11: 73,711,025 N265S possibly damaging Het
Zfp879 A G 11: 50,833,267 C321R probably damaging Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119049276 missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119026429 nonsense probably null
IGL00433:Uggt2 APN 14 119013487 missense probably benign
IGL00572:Uggt2 APN 14 119042791 missense probably benign 0.02
IGL00577:Uggt2 APN 14 119034900 missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119042799 missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119057645 missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119042772 missense probably benign 0.00
IGL01787:Uggt2 APN 14 119081734 missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119089193 missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119090738 missense probably benign 0.17
IGL02894:Uggt2 APN 14 119081799 missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119075346 missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119095310 missense probably benign 0.25
IGL03142:Uggt2 APN 14 118998191 missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119077668 missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119070888 missense probably benign 0.38
P0014:Uggt2 UTSW 14 119044538 missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119049663 missense probably benign 0.07
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0063:Uggt2 UTSW 14 119007130 splice site probably benign
R0383:Uggt2 UTSW 14 119049451 missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119075329 critical splice donor site probably null
R0472:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119095336 missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119057598 missense probably benign 0.27
R0788:Uggt2 UTSW 14 119095400 splice site probably benign
R0940:Uggt2 UTSW 14 119091192 critical splice donor site probably null
R1567:Uggt2 UTSW 14 119009093 missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119057663 missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119054643 missense probably benign 0.19
R1746:Uggt2 UTSW 14 119013503 missense probably benign 0.00
R1785:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119061376 missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119032276 missense probably benign 0.00
R1894:Uggt2 UTSW 14 119049718 missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119008055 splice site probably benign
R2149:Uggt2 UTSW 14 119075345 missense probably benign 0.02
R2168:Uggt2 UTSW 14 119019505 missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119075337 missense probably damaging 1.00
R2240:Uggt2 UTSW 14 118995049 missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119026599 missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119059109 missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2907:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2908:Uggt2 UTSW 14 119019507 missense probably benign 0.00
R2998:Uggt2 UTSW 14 119049385 missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119091270 missense probably benign 0.39
R3722:Uggt2 UTSW 14 119041518 missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119057672 missense probably benign 0.13
R4015:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119026433 missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119049262 missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119019558 missense probably benign
R4642:Uggt2 UTSW 14 119034935 missense probably benign 0.00
R4654:Uggt2 UTSW 14 119032258 missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119029054 splice site probably null
R4810:Uggt2 UTSW 14 119013521 missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119001847 missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119035964 splice site probably null
R4886:Uggt2 UTSW 14 119035964 splice site probably null
R4888:Uggt2 UTSW 14 119049253 missense probably damaging 1.00
R4888:Uggt2 UTSW 14 119077650 critical splice donor site probably null
R4895:Uggt2 UTSW 14 119018886 missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119081770 missense probably benign 0.00
R5423:Uggt2 UTSW 14 119019486 missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119090709 missense probably benign 0.01
R5561:Uggt2 UTSW 14 119041527 missense probably benign 0.02
R5607:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119089199 missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119077724 missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119042726 missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119049426 missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6031:Uggt2 UTSW 14 119070826 missense probably benign 0.06
R6056:Uggt2 UTSW 14 119035969 critical splice donor site probably null
R6289:Uggt2 UTSW 14 119041602 missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119057564 missense probably benign 0.01
R6515:Uggt2 UTSW 14 119077719 missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119070881 missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119042610 missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119026435 missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119001859 missense probably benign 0.10
R7117:Uggt2 UTSW 14 119014526 missense probably benign 0.25
R7183:Uggt2 UTSW 14 119019637 splice site probably null
R7337:Uggt2 UTSW 14 119086175 missense probably benign 0.28
R7342:Uggt2 UTSW 14 118994972 missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119089269 missense probably benign 0.12
R7625:Uggt2 UTSW 14 119026493 missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119075347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAACTCCCGAGCATGGTG -3'
(R):5'- CTCAGACTGGGCTGCAGAAATG -3'

Sequencing Primer
(F):5'- AGCATGGTGCCTGCCCTG -3'
(R):5'- GAAATGCCCTCCTGAAGCATTTGG -3'
Posted On2014-10-15