Mutagenetix > Incidental Mutations

Incidental Mutation 'R2220:Insrr'

241407

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

040222-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.332) question?

Stock #

R2220 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87809418 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 651 (L651P)

Ref Sequence

ENSEMBL: ENSMUSP00000103208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029711
AA Change: L651P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: L651P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107582
AA Change: L651P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: L651P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166771

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,875,530		probably null	Het
Aadacl4	T	C	4: 144,618,002	I116T	probably damaging	Het
Aatk	G	T	11: 120,012,177	F407L	probably damaging	Het
Abca8a	A	T	11: 110,026,855	L1586Q	probably damaging	Het
Aox2	A	G	1: 58,349,130		probably null	Het
Ap5m1	A	G	14: 49,081,095	D420G	probably damaging	Het
Bcl6	A	T	16: 23,972,632	L324*	probably null	Het
Bicc1	A	G	10: 70,950,125	S396P	probably damaging	Het
Ccdc83	G	A	7: 90,259,514	S4L	probably damaging	Het
Cdkal1	T	A	13: 29,354,758	M473L	probably benign	Het
Cep85	T	C	4: 134,153,867	H363R	probably damaging	Het
Cfap61	G	A	2: 146,036,816		probably null	Het
Cfap65	T	C	1: 74,904,025	I1614V	probably damaging	Het
Cluh	T	A	11: 74,667,121	F1062I	probably damaging	Het
Cntnap5a	A	T	1: 116,580,639	T1294S	possibly damaging	Het
Cops8	A	C	1: 90,606,619	N94T	probably benign	Het
Csmd1	T	C	8: 15,992,641	D2364G	possibly damaging	Het
Cyb5d1	T	C	11: 69,395,045	D55G	probably benign	Het
Cyp2c29	A	T	19: 39,287,232	I39F	probably benign	Het
Cyp2j8	T	C	4: 96,444,625	S495G	probably benign	Het
Dhx30	A	G	9: 110,087,635	L575P	probably damaging	Het
Dnah7a	C	T	1: 53,521,174	V2113I	probably benign	Het
Dusp3	T	C	11: 101,974,805	N95D	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam208b	A	T	13: 3,581,872	N876K	probably benign	Het
Fer1l4	T	G	2: 156,031,764	Y1207S	probably damaging	Het
Flg2	T	G	3: 93,202,185	S507A	unknown	Het
Gdf6	A	G	4: 9,844,770	H98R	probably damaging	Het
Ggnbp2	T	C	11: 84,836,613	N63S	possibly damaging	Het
Ggt7	A	G	2: 155,495,719	S504P	probably damaging	Het
Gm14548	A	T	7: 3,897,489	N87K	probably benign	Het
Gtf2h5	G	A	17: 6,084,578	E48K	probably benign	Het
Hivep3	T	G	4: 119,734,038	V81G	possibly damaging	Het
Igsf21	A	G	4: 140,028,114	M410T	probably damaging	Het
Iqcb1	A	T	16: 36,843,462		probably null	Het
Klhdc7a	G	A	4: 139,965,453	R728C	probably benign	Het
Lars2	T	C	9: 123,418,780	L334P	probably damaging	Het
Mast3	T	C	8: 70,780,963	E994G	probably damaging	Het
Mertk	T	A	2: 128,801,472	N930K	probably benign	Het
Mettl21a	A	T	1: 64,616,283	V46E	probably damaging	Het
Nedd4	T	A	9: 72,736,707	C614S	probably damaging	Het
Olfr168	A	T	16: 19,530,145	Y258*	probably null	Het
Olfr173	G	T	16: 58,797,624	A74D	possibly damaging	Het
Olfr525	T	C	7: 140,323,571	S291P	probably benign	Het
Pard3b	C	T	1: 62,479,683	R976*	probably null	Het
Pcdhb16	A	G	18: 37,478,967	T327A	probably benign	Het
Ppp1r37	C	A	7: 19,532,446	R465L	probably null	Het
Ppp3ca	C	A	3: 136,797,924	T86K	probably damaging	Het
Ralgapa2	G	A	2: 146,421,679	T706I	probably benign	Het
Rnf213	T	C	11: 119,436,428	L1747P	possibly damaging	Het
Slc11a1	T	A	1: 74,380,665	F166I	probably damaging	Het
Slc25a18	G	A	6: 120,793,557		probably null	Het
Stt3a	A	G	9: 36,749,551		probably null	Het
Supt16	G	A	14: 52,172,144	R770*	probably null	Het
Syde2	A	G	3: 146,001,958	I551V	probably benign	Het
Tecta	T	C	9: 42,392,030	D102G	probably damaging	Het
Tmc7	A	T	7: 118,552,816	I294N	possibly damaging	Het
Tmem174	T	C	13: 98,637,259	Y21C	probably damaging	Het
Tomm40l	A	T	1: 171,221,981	L13*	probably null	Het
Trim30c	A	G	7: 104,383,267	V284A	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Uggt2	A	T	14: 119,075,337	N353K	probably damaging	Het
Vps13d	C	T	4: 145,178,320	V79M	probably damaging	Het
Wfdc18	C	T	11: 83,709,913	R45*	probably null	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	splice site	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87808646	splice site	probably null
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87800490	missense	probably damaging	1.00
R1694:Insrr	UTSW	3	87804062	missense	probably benign
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87810700	splice site	probably null
R5685:Insrr	UTSW	3	87800496	splice site	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87815244	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87808594	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87803133	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87814316	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87808732	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87804531	splice site	probably null
R7815:Insrr	UTSW	3	87808695	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87800428	missense	probably damaging	1.00
R8289:Insrr	UTSW	3	87814194	missense	probably damaging	1.00
R8309:Insrr	UTSW	3	87810442	missense	probably benign	0.00
R8312:Insrr	UTSW	3	87800484	missense	possibly damaging	0.93
R8445:Insrr	UTSW	3	87813584	missense	probably damaging	1.00
RF022:Insrr	UTSW	3	87804485	missense	possibly damaging	0.51
Z1177:Insrr	UTSW	3	87800827	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GCTCAATATTTGGAAGGGTCCCAC -3'
(R):5'- AAGGACAGCAGCCTTGTTCC -3'

Sequencing Primer
(F):5'- CACCCCTGAGCGTCACC -3'
(R):5'- GCCTTGTTCCGGCTCAG -3'

Posted On

2014-10-15