Incidental Mutation 'R2220:Ccdc83'
ID241426
Institutional Source Beutler Lab
Gene Symbol Ccdc83
Ensembl Gene ENSMUSG00000030617
Gene Namecoiled-coil domain containing 83
Synonyms4930549K11Rik, 4930554C01Rik, 4932423M01Rik
MMRRC Submission 040222-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2220 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location90223873-90265777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90259514 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 4 (S4L)
Ref Sequence ENSEMBL: ENSMUSP00000102838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040413] [ENSMUST00000107220] [ENSMUST00000107221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040413
AA Change: S4L

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047758
Gene: ENSMUSG00000030617
AA Change: S4L

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107220
AA Change: S4L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102838
Gene: ENSMUSG00000030617
AA Change: S4L

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107221
AA Change: S4L

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102839
Gene: ENSMUSG00000030617
AA Change: S4L

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Blast:BROMO 202 232 1e-5 BLAST
low complexity region 241 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,875,530 probably null Het
Aadacl4 T C 4: 144,618,002 I116T probably damaging Het
Aatk G T 11: 120,012,177 F407L probably damaging Het
Abca8a A T 11: 110,026,855 L1586Q probably damaging Het
Aox2 A G 1: 58,349,130 probably null Het
Ap5m1 A G 14: 49,081,095 D420G probably damaging Het
Bcl6 A T 16: 23,972,632 L324* probably null Het
Bicc1 A G 10: 70,950,125 S396P probably damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cep85 T C 4: 134,153,867 H363R probably damaging Het
Cfap61 G A 2: 146,036,816 probably null Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Cluh T A 11: 74,667,121 F1062I probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Csmd1 T C 8: 15,992,641 D2364G possibly damaging Het
Cyb5d1 T C 11: 69,395,045 D55G probably benign Het
Cyp2c29 A T 19: 39,287,232 I39F probably benign Het
Cyp2j8 T C 4: 96,444,625 S495G probably benign Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dnah7a C T 1: 53,521,174 V2113I probably benign Het
Dusp3 T C 11: 101,974,805 N95D probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam208b A T 13: 3,581,872 N876K probably benign Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Flg2 T G 3: 93,202,185 S507A unknown Het
Gdf6 A G 4: 9,844,770 H98R probably damaging Het
Ggnbp2 T C 11: 84,836,613 N63S possibly damaging Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gtf2h5 G A 17: 6,084,578 E48K probably benign Het
Hivep3 T G 4: 119,734,038 V81G possibly damaging Het
Igsf21 A G 4: 140,028,114 M410T probably damaging Het
Insrr T C 3: 87,809,418 L651P probably damaging Het
Iqcb1 A T 16: 36,843,462 probably null Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mertk T A 2: 128,801,472 N930K probably benign Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Nedd4 T A 9: 72,736,707 C614S probably damaging Het
Olfr168 A T 16: 19,530,145 Y258* probably null Het
Olfr173 G T 16: 58,797,624 A74D possibly damaging Het
Olfr525 T C 7: 140,323,571 S291P probably benign Het
Pard3b C T 1: 62,479,683 R976* probably null Het
Pcdhb16 A G 18: 37,478,967 T327A probably benign Het
Ppp1r37 C A 7: 19,532,446 R465L probably null Het
Ppp3ca C A 3: 136,797,924 T86K probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Rnf213 T C 11: 119,436,428 L1747P possibly damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc25a18 G A 6: 120,793,557 probably null Het
Stt3a A G 9: 36,749,551 probably null Het
Supt16 G A 14: 52,172,144 R770* probably null Het
Syde2 A G 3: 146,001,958 I551V probably benign Het
Tecta T C 9: 42,392,030 D102G probably damaging Het
Tmc7 A T 7: 118,552,816 I294N possibly damaging Het
Tmem174 T C 13: 98,637,259 Y21C probably damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Trim30c A G 7: 104,383,267 V284A probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Vps13d C T 4: 145,178,320 V79M probably damaging Het
Wfdc18 C T 11: 83,709,913 R45* probably null Het
Other mutations in Ccdc83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ccdc83 APN 7 90244044 missense probably damaging 1.00
IGL01092:Ccdc83 APN 7 90247105 missense probably benign 0.11
IGL01394:Ccdc83 APN 7 90224001 missense probably damaging 1.00
IGL02585:Ccdc83 APN 7 90236912 missense probably damaging 1.00
IGL02631:Ccdc83 APN 7 90244069 missense possibly damaging 0.76
PIT4354001:Ccdc83 UTSW 7 90223974 missense probably benign 0.21
R0189:Ccdc83 UTSW 7 90226683 missense possibly damaging 0.94
R0538:Ccdc83 UTSW 7 90228383 missense probably damaging 0.99
R1441:Ccdc83 UTSW 7 90244143 missense probably damaging 1.00
R1478:Ccdc83 UTSW 7 90259469 missense probably damaging 0.99
R1781:Ccdc83 UTSW 7 90250541 missense probably damaging 1.00
R1929:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R1969:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1970:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1971:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R2008:Ccdc83 UTSW 7 90244141 missense probably damaging 1.00
R2271:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R2426:Ccdc83 UTSW 7 90228431 missense probably damaging 1.00
R2985:Ccdc83 UTSW 7 90236367 intron probably benign
R3712:Ccdc83 UTSW 7 90236355 intron probably benign
R4241:Ccdc83 UTSW 7 90247138 missense probably damaging 1.00
R4260:Ccdc83 UTSW 7 90228391 missense possibly damaging 0.86
R4374:Ccdc83 UTSW 7 90226778 nonsense probably null
R5071:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5072:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5074:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5749:Ccdc83 UTSW 7 90223948 missense probably damaging 1.00
R5929:Ccdc83 UTSW 7 90236316 intron probably benign
R6283:Ccdc83 UTSW 7 90236407 nonsense probably null
R6574:Ccdc83 UTSW 7 90226677 missense possibly damaging 0.69
R6725:Ccdc83 UTSW 7 90247053 missense probably damaging 1.00
R7320:Ccdc83 UTSW 7 90224034 missense probably damaging 1.00
R7485:Ccdc83 UTSW 7 90223930 missense probably benign 0.17
R7511:Ccdc83 UTSW 7 90236922 missense possibly damaging 0.69
R7750:Ccdc83 UTSW 7 90223982 nonsense probably null
R7773:Ccdc83 UTSW 7 90229912 missense probably damaging 1.00
R7950:Ccdc83 UTSW 7 90229787 splice site probably null
X0067:Ccdc83 UTSW 7 90247155 missense possibly damaging 0.94
Z1088:Ccdc83 UTSW 7 90244046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCAGTGCTTAGCTACATCAC -3'
(R):5'- ATGCTCTATCTGGGCTAAGCAC -3'

Sequencing Primer
(F):5'- AGTGCTTAGCTACATCACTCCAG -3'
(R):5'- GAATCCATCCGTTTAATGGTGC -3'
Posted On2014-10-15