Mutagenetix > Incidental Mutation

Incidental Mutation 'R2220:Mast3'

241431

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

040222-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2220 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70780963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 994 (E994G)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166004
AA Change: E1010G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: E1010G

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: E994G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

unknown
Transcript: ENSMUST00000212140
AA Change: E245G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,875,530		probably null	Het
Aadacl4	T	C	4: 144,618,002	I116T	probably damaging	Het
Aatk	G	T	11: 120,012,177	F407L	probably damaging	Het
Abca8a	A	T	11: 110,026,855	L1586Q	probably damaging	Het
Aox2	A	G	1: 58,349,130		probably null	Het
Ap5m1	A	G	14: 49,081,095	D420G	probably damaging	Het
Bcl6	A	T	16: 23,972,632	L324*	probably null	Het
Bicc1	A	G	10: 70,950,125	S396P	probably damaging	Het
Ccdc83	G	A	7: 90,259,514	S4L	probably damaging	Het
Cdkal1	T	A	13: 29,354,758	M473L	probably benign	Het
Cep85	T	C	4: 134,153,867	H363R	probably damaging	Het
Cfap61	G	A	2: 146,036,816		probably null	Het
Cfap65	T	C	1: 74,904,025	I1614V	probably damaging	Het
Cluh	T	A	11: 74,667,121	F1062I	probably damaging	Het
Cntnap5a	A	T	1: 116,580,639	T1294S	possibly damaging	Het
Cops8	A	C	1: 90,606,619	N94T	probably benign	Het
Csmd1	T	C	8: 15,992,641	D2364G	possibly damaging	Het
Cyb5d1	T	C	11: 69,395,045	D55G	probably benign	Het
Cyp2c29	A	T	19: 39,287,232	I39F	probably benign	Het
Cyp2j8	T	C	4: 96,444,625	S495G	probably benign	Het
Dhx30	A	G	9: 110,087,635	L575P	probably damaging	Het
Dnah7a	C	T	1: 53,521,174	V2113I	probably benign	Het
Dusp3	T	C	11: 101,974,805	N95D	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam208b	A	T	13: 3,581,872	N876K	probably benign	Het
Fer1l4	T	G	2: 156,031,764	Y1207S	probably damaging	Het
Flg2	T	G	3: 93,202,185	S507A	unknown	Het
Gdf6	A	G	4: 9,844,770	H98R	probably damaging	Het
Ggnbp2	T	C	11: 84,836,613	N63S	possibly damaging	Het
Ggt7	A	G	2: 155,495,719	S504P	probably damaging	Het
Gm14548	A	T	7: 3,897,489	N87K	probably benign	Het
Gtf2h5	G	A	17: 6,084,578	E48K	probably benign	Het
Hivep3	T	G	4: 119,734,038	V81G	possibly damaging	Het
Igsf21	A	G	4: 140,028,114	M410T	probably damaging	Het
Insrr	T	C	3: 87,809,418	L651P	probably damaging	Het
Iqcb1	A	T	16: 36,843,462		probably null	Het
Klhdc7a	G	A	4: 139,965,453	R728C	probably benign	Het
Lars2	T	C	9: 123,418,780	L334P	probably damaging	Het
Mertk	T	A	2: 128,801,472	N930K	probably benign	Het
Mettl21a	A	T	1: 64,616,283	V46E	probably damaging	Het
Nedd4	T	A	9: 72,736,707	C614S	probably damaging	Het
Olfr168	A	T	16: 19,530,145	Y258*	probably null	Het
Olfr173	G	T	16: 58,797,624	A74D	possibly damaging	Het
Olfr525	T	C	7: 140,323,571	S291P	probably benign	Het
Pard3b	C	T	1: 62,479,683	R976*	probably null	Het
Pcdhb16	A	G	18: 37,478,967	T327A	probably benign	Het
Ppp1r37	C	A	7: 19,532,446	R465L	probably null	Het
Ppp3ca	C	A	3: 136,797,924	T86K	probably damaging	Het
Ralgapa2	G	A	2: 146,421,679	T706I	probably benign	Het
Rnf213	T	C	11: 119,436,428	L1747P	possibly damaging	Het
Slc11a1	T	A	1: 74,380,665	F166I	probably damaging	Het
Slc25a18	G	A	6: 120,793,557		probably null	Het
Stt3a	A	G	9: 36,749,551		probably null	Het
Supt16	G	A	14: 52,172,144	R770*	probably null	Het
Syde2	A	G	3: 146,001,958	I551V	probably benign	Het
Tecta	T	C	9: 42,392,030	D102G	probably damaging	Het
Tmc7	A	T	7: 118,552,816	I294N	possibly damaging	Het
Tmem174	T	C	13: 98,637,259	Y21C	probably damaging	Het
Tomm40l	A	T	1: 171,221,981	L13*	probably null	Het
Trim30c	A	G	7: 104,383,267	V284A	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Uggt2	A	T	14: 119,075,337	N353K	probably damaging	Het
Vps13d	C	T	4: 145,178,320	V79M	probably damaging	Het
Wfdc18	C	T	11: 83,709,913	R45*	probably null	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATAAAAGGCTCGTGGTGTCAG -3'
(R):5'- GGGTGATAGTGACGTGTACAC -3'

Sequencing Primer
(F):5'- CTCGTGGTGTCAGGGACAG -3'
(R):5'- TCTGGGTGAGTCCTCGACAAAC -3'

Posted On

2014-10-15