Incidental Mutation 'R2220:Mast3'
ID 241431
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 040222-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2220 (G1)
Quality Score 210
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71233607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 994 (E994G)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect possibly damaging
Transcript: ENSMUST00000166004
AA Change: E1010G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: E1010G

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: E994G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000212140
AA Change: E245G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T C 4: 144,344,572 (GRCm39) I116T probably damaging Het
Aatk G T 11: 119,903,003 (GRCm39) F407L probably damaging Het
Abca8a A T 11: 109,917,681 (GRCm39) L1586Q probably damaging Het
Aox1 A G 1: 58,388,289 (GRCm39) probably null Het
Ap5m1 A G 14: 49,318,552 (GRCm39) D420G probably damaging Het
Bcl6 A T 16: 23,791,382 (GRCm39) L324* probably null Het
Bicc1 A G 10: 70,785,955 (GRCm39) S396P probably damaging Het
Bltp1 T C 3: 36,929,679 (GRCm39) probably null Het
Ccdc83 G A 7: 89,908,722 (GRCm39) S4L probably damaging Het
Cdkal1 T A 13: 29,538,741 (GRCm39) M473L probably benign Het
Cep85 T C 4: 133,881,178 (GRCm39) H363R probably damaging Het
Cfap61 G A 2: 145,878,736 (GRCm39) probably null Het
Cfap65 T C 1: 74,943,184 (GRCm39) I1614V probably damaging Het
Cluh T A 11: 74,557,947 (GRCm39) F1062I probably damaging Het
Cntnap5a A T 1: 116,508,369 (GRCm39) T1294S possibly damaging Het
Cops8 A C 1: 90,534,341 (GRCm39) N94T probably benign Het
Csmd1 T C 8: 16,042,641 (GRCm39) D2364G possibly damaging Het
Cyb5d1 T C 11: 69,285,871 (GRCm39) D55G probably benign Het
Cyp2c29 A T 19: 39,275,676 (GRCm39) I39F probably benign Het
Cyp2j8 T C 4: 96,332,862 (GRCm39) S495G probably benign Het
Dhx30 A G 9: 109,916,703 (GRCm39) L575P probably damaging Het
Dnah7a C T 1: 53,560,333 (GRCm39) V2113I probably benign Het
Dusp3 T C 11: 101,865,631 (GRCm39) N95D probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fer1l4 T G 2: 155,873,684 (GRCm39) Y1207S probably damaging Het
Flg2 T G 3: 93,109,492 (GRCm39) S507A unknown Het
Gdf6 A G 4: 9,844,770 (GRCm39) H98R probably damaging Het
Ggnbp2 T C 11: 84,727,439 (GRCm39) N63S possibly damaging Het
Ggt7 A G 2: 155,337,639 (GRCm39) S504P probably damaging Het
Gtf2h5 G A 17: 6,134,853 (GRCm39) E48K probably benign Het
Hivep3 T G 4: 119,591,235 (GRCm39) V81G possibly damaging Het
Igsf21 A G 4: 139,755,425 (GRCm39) M410T probably damaging Het
Insrr T C 3: 87,716,725 (GRCm39) L651P probably damaging Het
Iqcb1 A T 16: 36,663,824 (GRCm39) probably null Het
Klhdc7a G A 4: 139,692,764 (GRCm39) R728C probably benign Het
Lars2 T C 9: 123,247,845 (GRCm39) L334P probably damaging Het
Mertk T A 2: 128,643,392 (GRCm39) N930K probably benign Het
Mettl21a A T 1: 64,655,442 (GRCm39) V46E probably damaging Het
Nedd4 T A 9: 72,643,989 (GRCm39) C614S probably damaging Het
Or13a19 T C 7: 139,903,484 (GRCm39) S291P probably benign Het
Or2l13b A T 16: 19,348,895 (GRCm39) Y258* probably null Het
Or5k1 G T 16: 58,617,987 (GRCm39) A74D possibly damaging Het
Pard3b C T 1: 62,518,842 (GRCm39) R976* probably null Het
Pcdhb16 A G 18: 37,612,020 (GRCm39) T327A probably benign Het
Pira12 A T 7: 3,900,488 (GRCm39) N87K probably benign Het
Ppp1r37 C A 7: 19,266,371 (GRCm39) R465L probably null Het
Ppp3ca C A 3: 136,503,685 (GRCm39) T86K probably damaging Het
Ralgapa2 G A 2: 146,263,599 (GRCm39) T706I probably benign Het
Rnf213 T C 11: 119,327,254 (GRCm39) L1747P possibly damaging Het
Slc11a1 T A 1: 74,419,824 (GRCm39) F166I probably damaging Het
Slc25a18 G A 6: 120,770,518 (GRCm39) probably null Het
Stt3a A G 9: 36,660,847 (GRCm39) probably null Het
Supt16 G A 14: 52,409,601 (GRCm39) R770* probably null Het
Syde2 A G 3: 145,707,713 (GRCm39) I551V probably benign Het
Tasor2 A T 13: 3,631,872 (GRCm39) N876K probably benign Het
Tecta T C 9: 42,303,326 (GRCm39) D102G probably damaging Het
Tmc7 A T 7: 118,152,039 (GRCm39) I294N possibly damaging Het
Tmem174 T C 13: 98,773,767 (GRCm39) Y21C probably damaging Het
Tomm40l A T 1: 171,049,550 (GRCm39) L13* probably null Het
Trim30c A G 7: 104,032,474 (GRCm39) V284A probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Uggt2 A T 14: 119,312,749 (GRCm39) N353K probably damaging Het
Vps13d C T 4: 144,904,890 (GRCm39) V79M probably damaging Het
Wfdc18 C T 11: 83,600,739 (GRCm39) R45* probably null Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATAAAAGGCTCGTGGTGTCAG -3'
(R):5'- GGGTGATAGTGACGTGTACAC -3'

Sequencing Primer
(F):5'- CTCGTGGTGTCAGGGACAG -3'
(R):5'- TCTGGGTGAGTCCTCGACAAAC -3'
Posted On 2014-10-15