Mutagenetix > Incidental Mutation

Incidental Mutation 'R2220:Lars2'

241437

Institutional Source

Beutler Lab

Gene Symbol

Lars2

Ensembl Gene

ENSMUSG00000035202

Gene Name

leucyl-tRNA synthetase, mitochondrial

Synonyms

Kiaa0028

MMRRC Submission

040222-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2220 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123366927-123462666 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123418780 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 334 (L334P)

Ref Sequence

ENSEMBL: ENSMUSP00000150083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000217116]

AlphaFold

Q8VDC0

Predicted Effect

probably damaging
Transcript: ENSMUST00000038863
AA Change: L334P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: L334P

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	57	223	7.6e-24	PFAM
Pfam:tRNA-synt_1g	83	239	9.3e-20	PFAM
Pfam:tRNA-synt_1_2	269	430	1.1e-8	PFAM
Pfam:tRNA-synt_1	434	609	5.6e-8	PFAM
Pfam:tRNA-synt_1g	589	682	1.2e-6	PFAM
Pfam:tRNA-synt_1	633	678	1.6e-7	PFAM
Pfam:Anticodon_1	724	867	9.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214557

Predicted Effect

probably damaging
Transcript: ENSMUST00000217116
AA Change: L334P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,875,530		probably null	Het
Aadacl4	T	C	4: 144,618,002	I116T	probably damaging	Het
Aatk	G	T	11: 120,012,177	F407L	probably damaging	Het
Abca8a	A	T	11: 110,026,855	L1586Q	probably damaging	Het
Aox2	A	G	1: 58,349,130		probably null	Het
Ap5m1	A	G	14: 49,081,095	D420G	probably damaging	Het
Bcl6	A	T	16: 23,972,632	L324*	probably null	Het
Bicc1	A	G	10: 70,950,125	S396P	probably damaging	Het
Ccdc83	G	A	7: 90,259,514	S4L	probably damaging	Het
Cdkal1	T	A	13: 29,354,758	M473L	probably benign	Het
Cep85	T	C	4: 134,153,867	H363R	probably damaging	Het
Cfap61	G	A	2: 146,036,816		probably null	Het
Cfap65	T	C	1: 74,904,025	I1614V	probably damaging	Het
Cluh	T	A	11: 74,667,121	F1062I	probably damaging	Het
Cntnap5a	A	T	1: 116,580,639	T1294S	possibly damaging	Het
Cops8	A	C	1: 90,606,619	N94T	probably benign	Het
Csmd1	T	C	8: 15,992,641	D2364G	possibly damaging	Het
Cyb5d1	T	C	11: 69,395,045	D55G	probably benign	Het
Cyp2c29	A	T	19: 39,287,232	I39F	probably benign	Het
Cyp2j8	T	C	4: 96,444,625	S495G	probably benign	Het
Dhx30	A	G	9: 110,087,635	L575P	probably damaging	Het
Dnah7a	C	T	1: 53,521,174	V2113I	probably benign	Het
Dusp3	T	C	11: 101,974,805	N95D	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam208b	A	T	13: 3,581,872	N876K	probably benign	Het
Fer1l4	T	G	2: 156,031,764	Y1207S	probably damaging	Het
Flg2	T	G	3: 93,202,185	S507A	unknown	Het
Gdf6	A	G	4: 9,844,770	H98R	probably damaging	Het
Ggnbp2	T	C	11: 84,836,613	N63S	possibly damaging	Het
Ggt7	A	G	2: 155,495,719	S504P	probably damaging	Het
Gm14548	A	T	7: 3,897,489	N87K	probably benign	Het
Gtf2h5	G	A	17: 6,084,578	E48K	probably benign	Het
Hivep3	T	G	4: 119,734,038	V81G	possibly damaging	Het
Igsf21	A	G	4: 140,028,114	M410T	probably damaging	Het
Insrr	T	C	3: 87,809,418	L651P	probably damaging	Het
Iqcb1	A	T	16: 36,843,462		probably null	Het
Klhdc7a	G	A	4: 139,965,453	R728C	probably benign	Het
Mast3	T	C	8: 70,780,963	E994G	probably damaging	Het
Mertk	T	A	2: 128,801,472	N930K	probably benign	Het
Mettl21a	A	T	1: 64,616,283	V46E	probably damaging	Het
Nedd4	T	A	9: 72,736,707	C614S	probably damaging	Het
Olfr168	A	T	16: 19,530,145	Y258*	probably null	Het
Olfr173	G	T	16: 58,797,624	A74D	possibly damaging	Het
Olfr525	T	C	7: 140,323,571	S291P	probably benign	Het
Pard3b	C	T	1: 62,479,683	R976*	probably null	Het
Pcdhb16	A	G	18: 37,478,967	T327A	probably benign	Het
Ppp1r37	C	A	7: 19,532,446	R465L	probably null	Het
Ppp3ca	C	A	3: 136,797,924	T86K	probably damaging	Het
Ralgapa2	G	A	2: 146,421,679	T706I	probably benign	Het
Rnf213	T	C	11: 119,436,428	L1747P	possibly damaging	Het
Slc11a1	T	A	1: 74,380,665	F166I	probably damaging	Het
Slc25a18	G	A	6: 120,793,557		probably null	Het
Stt3a	A	G	9: 36,749,551		probably null	Het
Supt16	G	A	14: 52,172,144	R770*	probably null	Het
Syde2	A	G	3: 146,001,958	I551V	probably benign	Het
Tecta	T	C	9: 42,392,030	D102G	probably damaging	Het
Tmc7	A	T	7: 118,552,816	I294N	possibly damaging	Het
Tmem174	T	C	13: 98,637,259	Y21C	probably damaging	Het
Tomm40l	A	T	1: 171,221,981	L13*	probably null	Het
Trim30c	A	G	7: 104,383,267	V284A	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Uggt2	A	T	14: 119,075,337	N353K	probably damaging	Het
Vps13d	C	T	4: 145,178,320	V79M	probably damaging	Het
Wfdc18	C	T	11: 83,709,913	R45*	probably null	Het

Other mutations in Lars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01743:Lars2	APN	9	123453248	missense	probably damaging	0.98
IGL01993:Lars2	APN	9	123394943	splice site	probably benign
IGL02155:Lars2	APN	9	123454982	missense	probably damaging	0.99
IGL02941:Lars2	APN	9	123459585	missense	probably damaging	0.97
IGL03090:Lars2	APN	9	123455960	missense	probably damaging	1.00
IGL03271:Lars2	APN	9	123459484	splice site	probably null
IGL03386:Lars2	APN	9	123453390	nonsense	probably null
IGL03410:Lars2	APN	9	123418776	missense	possibly damaging	0.87
ulrich	UTSW	9	123418693	missense	probably damaging	0.99
K3955:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
P0038:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
R0276:Lars2	UTSW	9	123438121	splice site	probably benign
R1671:Lars2	UTSW	9	123418279	missense	probably benign	0.02
R1829:Lars2	UTSW	9	123431917	missense	probably benign	0.00
R2219:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R4610:Lars2	UTSW	9	123418693	missense	probably damaging	0.99
R5027:Lars2	UTSW	9	123441495	missense	probably benign	0.38
R5195:Lars2	UTSW	9	123453310	missense	probably damaging	0.97
R5597:Lars2	UTSW	9	123454982	missense	probably damaging	0.99
R5756:Lars2	UTSW	9	123438199	missense	probably damaging	1.00
R5783:Lars2	UTSW	9	123461596	missense	probably benign
R6045:Lars2	UTSW	9	123371988	missense	probably damaging	1.00
R6235:Lars2	UTSW	9	123411880	missense	probably damaging	1.00
R6323:Lars2	UTSW	9	123441594	nonsense	probably null
R6377:Lars2	UTSW	9	123454760	missense	probably benign	0.00
R6395:Lars2	UTSW	9	123371925	missense	probably benign	0.06
R7094:Lars2	UTSW	9	123459585	missense	probably damaging	0.99
R7144:Lars2	UTSW	9	123431993	missense	probably damaging	1.00
R7233:Lars2	UTSW	9	123411954	nonsense	probably null
R7254:Lars2	UTSW	9	123454963	missense	possibly damaging	0.93
R7350:Lars2	UTSW	9	123427480	missense	probably damaging	1.00
R7413:Lars2	UTSW	9	123459503	missense	probably benign	0.30
R7614:Lars2	UTSW	9	123395111	missense
R7683:Lars2	UTSW	9	123377830	critical splice donor site	probably null
R8000:Lars2	UTSW	9	123436244	missense	probably damaging	1.00
R8061:Lars2	UTSW	9	123459497	missense	probably benign
R8355:Lars2	UTSW	9	123454715	missense	probably damaging	1.00
R8364:Lars2	UTSW	9	123411954	nonsense	probably null
R8818:Lars2	UTSW	9	123392827	missense	possibly damaging	0.94
R9007:Lars2	UTSW	9	123431915	nonsense	probably null
R9351:Lars2	UTSW	9	123436301	missense	probably benign	0.38
Z1177:Lars2	UTSW	9	123454782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCTGCCAAGGCTGTTTG -3'
(R):5'- CCAATCTAATGTTCCCAGAGCTG -3'

Sequencing Primer
(F):5'- AGCCCCAGAACTTAGGGG -3'
(R):5'- CAGAGCTGTCTTACCTCAGG -3'

Posted On

2014-10-15