Mutagenetix > Incidental Mutation

Incidental Mutation 'R2220:Espl1'

241456

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

040222-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2220 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102312989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 944 (I944V)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I944V

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230120

Meta Mutation Damage Score

0.1426

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,875,530		probably null	Het
Aadacl4	T	C	4: 144,618,002	I116T	probably damaging	Het
Aatk	G	T	11: 120,012,177	F407L	probably damaging	Het
Abca8a	A	T	11: 110,026,855	L1586Q	probably damaging	Het
Aox2	A	G	1: 58,349,130		probably null	Het
Ap5m1	A	G	14: 49,081,095	D420G	probably damaging	Het
Bcl6	A	T	16: 23,972,632	L324*	probably null	Het
Bicc1	A	G	10: 70,950,125	S396P	probably damaging	Het
Ccdc83	G	A	7: 90,259,514	S4L	probably damaging	Het
Cdkal1	T	A	13: 29,354,758	M473L	probably benign	Het
Cep85	T	C	4: 134,153,867	H363R	probably damaging	Het
Cfap61	G	A	2: 146,036,816		probably null	Het
Cfap65	T	C	1: 74,904,025	I1614V	probably damaging	Het
Cluh	T	A	11: 74,667,121	F1062I	probably damaging	Het
Cntnap5a	A	T	1: 116,580,639	T1294S	possibly damaging	Het
Cops8	A	C	1: 90,606,619	N94T	probably benign	Het
Csmd1	T	C	8: 15,992,641	D2364G	possibly damaging	Het
Cyb5d1	T	C	11: 69,395,045	D55G	probably benign	Het
Cyp2c29	A	T	19: 39,287,232	I39F	probably benign	Het
Cyp2j8	T	C	4: 96,444,625	S495G	probably benign	Het
Dhx30	A	G	9: 110,087,635	L575P	probably damaging	Het
Dnah7a	C	T	1: 53,521,174	V2113I	probably benign	Het
Dusp3	T	C	11: 101,974,805	N95D	probably damaging	Het
Fam208b	A	T	13: 3,581,872	N876K	probably benign	Het
Fer1l4	T	G	2: 156,031,764	Y1207S	probably damaging	Het
Flg2	T	G	3: 93,202,185	S507A	unknown	Het
Gdf6	A	G	4: 9,844,770	H98R	probably damaging	Het
Ggnbp2	T	C	11: 84,836,613	N63S	possibly damaging	Het
Ggt7	A	G	2: 155,495,719	S504P	probably damaging	Het
Gm14548	A	T	7: 3,897,489	N87K	probably benign	Het
Gtf2h5	G	A	17: 6,084,578	E48K	probably benign	Het
Hivep3	T	G	4: 119,734,038	V81G	possibly damaging	Het
Igsf21	A	G	4: 140,028,114	M410T	probably damaging	Het
Insrr	T	C	3: 87,809,418	L651P	probably damaging	Het
Iqcb1	A	T	16: 36,843,462		probably null	Het
Klhdc7a	G	A	4: 139,965,453	R728C	probably benign	Het
Lars2	T	C	9: 123,418,780	L334P	probably damaging	Het
Mast3	T	C	8: 70,780,963	E994G	probably damaging	Het
Mertk	T	A	2: 128,801,472	N930K	probably benign	Het
Mettl21a	A	T	1: 64,616,283	V46E	probably damaging	Het
Nedd4	T	A	9: 72,736,707	C614S	probably damaging	Het
Olfr168	A	T	16: 19,530,145	Y258*	probably null	Het
Olfr173	G	T	16: 58,797,624	A74D	possibly damaging	Het
Olfr525	T	C	7: 140,323,571	S291P	probably benign	Het
Pard3b	C	T	1: 62,479,683	R976*	probably null	Het
Pcdhb16	A	G	18: 37,478,967	T327A	probably benign	Het
Ppp1r37	C	A	7: 19,532,446	R465L	probably null	Het
Ppp3ca	C	A	3: 136,797,924	T86K	probably damaging	Het
Ralgapa2	G	A	2: 146,421,679	T706I	probably benign	Het
Rnf213	T	C	11: 119,436,428	L1747P	possibly damaging	Het
Slc11a1	T	A	1: 74,380,665	F166I	probably damaging	Het
Slc25a18	G	A	6: 120,793,557		probably null	Het
Stt3a	A	G	9: 36,749,551		probably null	Het
Supt16	G	A	14: 52,172,144	R770*	probably null	Het
Syde2	A	G	3: 146,001,958	I551V	probably benign	Het
Tecta	T	C	9: 42,392,030	D102G	probably damaging	Het
Tmc7	A	T	7: 118,552,816	I294N	possibly damaging	Het
Tmem174	T	C	13: 98,637,259	Y21C	probably damaging	Het
Tomm40l	A	T	1: 171,221,981	L13*	probably null	Het
Trim30c	A	G	7: 104,383,267	V284A	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Uggt2	A	T	14: 119,075,337	N353K	probably damaging	Het
Vps13d	C	T	4: 145,178,320	V79M	probably damaging	Het
Wfdc18	C	T	11: 83,709,913	R45*	probably null	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTAGAGGGAAAGAGCTCTGTGTTC -3'
(R):5'- TGCACCAGATTCTCACCTGC -3'

Sequencing Primer
(F):5'- GGAAAGAGCTCTGTGTTCAATTAG -3'
(R):5'- CTGCGGTGAATGAAAGACAGACATC -3'

Posted On

2014-10-15