Incidental Mutation 'R0166:Cst7'
ID24147
Institutional Source Beutler Lab
Gene Symbol Cst7
Ensembl Gene ENSMUSG00000068129
Gene Namecystatin F (leukocystatin)
Synonymscystatin-like metastasis-associated protein, CMAP, Leukocystatin
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location150570415-150578944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150575727 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 31 (S31P)
Ref Sequence ENSEMBL: ENSMUSP00000086606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089200]
Predicted Effect probably benign
Transcript: ENSMUST00000089200
AA Change: S31P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000086606
Gene: ENSMUSG00000068129
AA Change: S31P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 33 144 1.04e-22 SMART
Meta Mutation Damage Score 0.1083 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y264* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Cst7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0530:Cst7 UTSW 2 150570515 start gained probably benign
R0606:Cst7 UTSW 2 150570519 start codon destroyed probably benign 0.08
R0620:Cst7 UTSW 2 150575886 splice site probably benign
R1856:Cst7 UTSW 2 150577708 missense probably damaging 1.00
R5556:Cst7 UTSW 2 150570568 missense probably benign
R7315:Cst7 UTSW 2 150570583 missense probably benign 0.00
R7487:Cst7 UTSW 2 150577704 missense probably benign 0.07
R7509:Cst7 UTSW 2 150577704 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGCTCTGACAAGGTGTGAGACTG -3'
(R):5'- AGGTGCCAGCTATTGATCCTAGCTC -3'

Sequencing Primer
(F):5'- CCCTGGGTTCTGAAAAAGGTC -3'
(R):5'- TCCTCACCTGTACCAGGGC -3'
Posted On2013-04-16