Mutagenetix > Incidental Mutations

Incidental Mutation 'R2221:Prdm2'

241480

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

040223-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2221 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143134899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 607 (N607S)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105778
AA Change: N607S

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: N607S

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Meta Mutation Damage Score

0.1825

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,247,457		probably null	Het
Adamtsl1	A	C	4: 86,388,525	D1392A	probably benign	Het
Afdn	T	C	17: 13,883,737		probably benign	Het
Aph1b	A	T	9: 66,784,639	M121K	probably damaging	Het
Aspg	G	A	12: 112,114,434	A120T	probably damaging	Het
Bicd1	A	G	6: 149,517,005	T725A	probably damaging	Het
Cd1d2	A	T	3: 86,988,540	I292F	probably damaging	Het
Cdk13	A	G	13: 17,719,535	V495A	probably damaging	Het
Cfd	A	T	10: 79,892,205		probably null	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Cradd	A	C	10: 95,175,873	V135G	probably benign	Het
Cry1	A	G	10: 85,143,753	C460R	probably damaging	Het
Ctu2	A	G	8: 122,480,910	E375G	probably damaging	Het
Dym	T	G	18: 75,230,165	I580S	probably damaging	Het
Eif3e	A	G	15: 43,251,547	L411P	possibly damaging	Het
Emsy	T	C	7: 98,590,775	E1091G	possibly damaging	Het
Enkur	A	G	2: 21,189,319		probably benign	Het
Fam184a	G	A	10: 53,655,079	T733M	probably damaging	Het
Frem2	G	A	3: 53,516,857	A3053V	probably benign	Het
Gbgt1	T	C	2: 28,498,423	L40P	probably damaging	Het
Gm5174	T	A	10: 86,656,508		noncoding transcript	Het
Gys2	G	T	6: 142,456,422	D230E	probably damaging	Het
Herc2	T	A	7: 56,169,018		probably null	Het
Hps3	A	T	3: 20,002,363	S815R	probably benign	Het
Igf1r	C	A	7: 68,201,962	S983R	probably damaging	Het
Itsn1	T	A	16: 91,853,768		probably benign	Het
Kcnc2	A	G	10: 112,456,526	N91D	probably damaging	Het
Kif28	C	A	1: 179,733,111	A210S	possibly damaging	Het
Klri2	T	A	6: 129,740,309	Q37L	probably damaging	Het
Lrrc38	T	A	4: 143,369,849	C243*	probably null	Het
Map3k5	T	C	10: 20,067,920	V590A	possibly damaging	Het
Mdn1	C	A	4: 32,763,306	F5135L	probably benign	Het
Megf11	G	A	9: 64,660,431	G401S	possibly damaging	Het
Mst1r	T	C	9: 107,908,348	F402L	probably damaging	Het
Ntrk3	T	C	7: 78,198,852	I759V	probably damaging	Het
Nup188	T	C	2: 30,336,924		probably benign	Het
Olfr1243	C	T	2: 89,527,937	V158I	probably benign	Het
Olfr870	T	C	9: 20,171,092	S160G	possibly damaging	Het
Prl2a1	T	A	13: 27,806,386		probably null	Het
Serpina9	T	A	12: 103,998,264	I305F	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc19a1	C	T	10: 77,042,486	T285I	probably benign	Het
Snap91	T	C	9: 86,792,527	T544A	possibly damaging	Het
Srgap3	A	G	6: 112,946,493	S2P	probably damaging	Het
Tcof1	A	G	18: 60,837,901	V210A	possibly damaging	Het
Tex261	A	G	6: 83,771,515	I136T	probably benign	Het
Trpa1	A	T	1: 14,903,256	F279L	probably null	Het
Ttc39b	T	C	4: 83,232,762	N532S	probably benign	Het
Ttn	T	C	2: 76,742,094	T26152A	probably damaging	Het
Ube2w	A	G	1: 16,597,959	S97P	possibly damaging	Het
Vmn1r25	A	C	6: 57,979,238	L22R	probably damaging	Het
Vmn1r64	T	C	7: 5,884,449	I32V	probably benign	Het
Vmn2r112	T	G	17: 22,601,233	M29R	possibly damaging	Het
Vmn2r71	T	A	7: 85,624,093	M705K	probably benign	Het
Vps13b	G	A	15: 35,884,597	V3139I	probably benign	Het
Zfp628	T	C	7: 4,920,831	V684A	probably benign	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTCAGAGGCAGACTTAAGG -3'
(R):5'- TCTATGTACCAAGCACAGAGC -3'

Sequencing Primer
(F):5'- CTCAGAGGCAGACTTAAGGAACAC -3'
(R):5'- CGCAGATGATGTGTATATCATGGAC -3'

Posted On

2014-10-15