Incidental Mutation 'R2221:Emsy'
ID241495
Institutional Source Beutler Lab
Gene Symbol Emsy
Ensembl Gene ENSMUSG00000035401
Gene NameEMSY, BRCA2-interacting transcriptional repressor
Synonyms2210018M11Rik
MMRRC Submission 040223-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R2221 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98587137-98656783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98590775 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1091 (E1091G)
Ref Sequence ENSEMBL: ENSMUSP00000038216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038359] [ENSMUST00000205276] [ENSMUST00000205886] [ENSMUST00000205911]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038359
AA Change: E1091G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038216
Gene: ENSMUSG00000035401
AA Change: E1091G

DomainStartEndE-ValueType
ENT 16 88 2.44e-29 SMART
low complexity region 94 104 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
low complexity region 293 331 N/A INTRINSIC
low complexity region 363 406 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 681 698 N/A INTRINSIC
low complexity region 807 816 N/A INTRINSIC
low complexity region 866 882 N/A INTRINSIC
low complexity region 893 909 N/A INTRINSIC
low complexity region 1197 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205276
AA Change: E1237G

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205513
Predicted Effect probably benign
Transcript: ENSMUST00000205886
Predicted Effect unknown
Transcript: ENSMUST00000205911
AA Change: E1043G
Meta Mutation Damage Score 0.1065 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Bicd1 A G 6: 149,517,005 T725A probably damaging Het
Cd1d2 A T 3: 86,988,540 I292F probably damaging Het
Cdk13 A G 13: 17,719,535 V495A probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Ctu2 A G 8: 122,480,910 E375G probably damaging Het
Dym T G 18: 75,230,165 I580S probably damaging Het
Eif3e A G 15: 43,251,547 L411P possibly damaging Het
Enkur A G 2: 21,189,319 probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Frem2 G A 3: 53,516,857 A3053V probably benign Het
Gbgt1 T C 2: 28,498,423 L40P probably damaging Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gys2 G T 6: 142,456,422 D230E probably damaging Het
Herc2 T A 7: 56,169,018 probably null Het
Hps3 A T 3: 20,002,363 S815R probably benign Het
Igf1r C A 7: 68,201,962 S983R probably damaging Het
Itsn1 T A 16: 91,853,768 probably benign Het
Kcnc2 A G 10: 112,456,526 N91D probably damaging Het
Kif28 C A 1: 179,733,111 A210S possibly damaging Het
Klri2 T A 6: 129,740,309 Q37L probably damaging Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Mdn1 C A 4: 32,763,306 F5135L probably benign Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mst1r T C 9: 107,908,348 F402L probably damaging Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Nup188 T C 2: 30,336,924 probably benign Het
Olfr1243 C T 2: 89,527,937 V158I probably benign Het
Olfr870 T C 9: 20,171,092 S160G possibly damaging Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Prl2a1 T A 13: 27,806,386 probably null Het
Serpina9 T A 12: 103,998,264 I305F probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc19a1 C T 10: 77,042,486 T285I probably benign Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Srgap3 A G 6: 112,946,493 S2P probably damaging Het
Tcof1 A G 18: 60,837,901 V210A possibly damaging Het
Tex261 A G 6: 83,771,515 I136T probably benign Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ttn T C 2: 76,742,094 T26152A probably damaging Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn1r64 T C 7: 5,884,449 I32V probably benign Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Vps13b G A 15: 35,884,597 V3139I probably benign Het
Zfp628 T C 7: 4,920,831 V684A probably benign Het
Other mutations in Emsy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Emsy APN 7 98593455 missense probably benign 0.09
IGL01357:Emsy APN 7 98590870 nonsense probably null
IGL01620:Emsy APN 7 98626624 missense probably damaging 1.00
IGL01750:Emsy APN 7 98619301 missense probably damaging 0.99
IGL02032:Emsy APN 7 98590780 missense possibly damaging 0.94
IGL02388:Emsy APN 7 98641666 missense probably damaging 0.99
IGL03089:Emsy APN 7 98637266 nonsense probably null
IGL03272:Emsy APN 7 98593762 missense probably damaging 0.98
IGL03347:Emsy APN 7 98610685 missense probably damaging 0.99
IGL03400:Emsy APN 7 98602726 missense possibly damaging 0.94
IGL02980:Emsy UTSW 7 98619380 missense probably damaging 0.97
R0576:Emsy UTSW 7 98593776 missense probably damaging 0.99
R1102:Emsy UTSW 7 98602589 missense probably damaging 0.97
R1323:Emsy UTSW 7 98610657 splice site probably benign
R1438:Emsy UTSW 7 98621406 missense possibly damaging 0.88
R1439:Emsy UTSW 7 98600841 intron probably benign
R1452:Emsy UTSW 7 98600674 missense probably damaging 0.96
R1515:Emsy UTSW 7 98590856 missense probably damaging 1.00
R1535:Emsy UTSW 7 98593737 missense possibly damaging 0.94
R1791:Emsy UTSW 7 98647880 missense probably damaging 0.99
R1829:Emsy UTSW 7 98602729 missense possibly damaging 0.95
R1829:Emsy UTSW 7 98602730 missense possibly damaging 0.88
R1848:Emsy UTSW 7 98600821 missense probably damaging 0.99
R1861:Emsy UTSW 7 98641615 missense probably damaging 1.00
R1929:Emsy UTSW 7 98626623 missense probably damaging 0.99
R1957:Emsy UTSW 7 98647820 missense probably damaging 1.00
R2223:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2271:Emsy UTSW 7 98626623 missense probably damaging 0.99
R4078:Emsy UTSW 7 98590725 missense probably damaging 0.99
R4707:Emsy UTSW 7 98597104 missense possibly damaging 0.94
R4783:Emsy UTSW 7 98646479 missense possibly damaging 0.74
R5453:Emsy UTSW 7 98600806 missense probably damaging 0.97
R5518:Emsy UTSW 7 98593611 missense possibly damaging 0.86
R5828:Emsy UTSW 7 98593492 missense probably benign
R5945:Emsy UTSW 7 98619383 missense probably damaging 0.97
R6153:Emsy UTSW 7 98610853 missense probably damaging 1.00
R6824:Emsy UTSW 7 98593407 missense probably benign 0.27
R7068:Emsy UTSW 7 98610761 missense probably benign 0.17
R7381:Emsy UTSW 7 98590803 missense probably damaging 0.98
R7417:Emsy UTSW 7 98615486 missense probably damaging 1.00
R7488:Emsy UTSW 7 98615555 missense possibly damaging 0.94
R7499:Emsy UTSW 7 98630331 missense possibly damaging 0.59
R7646:Emsy UTSW 7 98619353 missense probably damaging 1.00
R7682:Emsy UTSW 7 98590698 missense probably damaging 0.99
R7716:Emsy UTSW 7 98599766 missense unknown
R7789:Emsy UTSW 7 98621489 missense probably damaging 1.00
R7794:Emsy UTSW 7 98600724 missense probably benign 0.30
R7832:Emsy UTSW 7 98639853 missense probably damaging 1.00
R7974:Emsy UTSW 7 98630218 missense possibly damaging 0.73
R7996:Emsy UTSW 7 98593681 missense probably benign 0.00
R8070:Emsy UTSW 7 98626715 missense possibly damaging 0.73
R8221:Emsy UTSW 7 98647904 missense probably damaging 1.00
X0067:Emsy UTSW 7 98630240 missense possibly damaging 0.65
Z1088:Emsy UTSW 7 98600722 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTCCCCAGCCTAAATATGAGC -3'
(R):5'- GAAGGACACAGTCTCCTCTTG -3'

Sequencing Primer
(F):5'- CAGCCTAAATATGAGCAAAGTGC -3'
(R):5'- TGGCTTTTCCACTATAAACATTCTC -3'
Posted On2014-10-15