Incidental Mutation 'R2221:Olfr870'
ID241498
Institutional Source Beutler Lab
Gene Symbol Olfr870
Ensembl Gene ENSMUSG00000066899
Gene Nameolfactory receptor 870
SynonymsGA_x6K02T2PVTD-13912679-13911744, MOR141-1
MMRRC Submission 040223-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2221 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20168533-20174057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20171092 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 160 (S160G)
Ref Sequence ENSEMBL: ENSMUSP00000150084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086476] [ENSMUST00000215984]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086476
AA Change: S160G

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091405
Gene: ENSMUSG00000066899
AA Change: S160G

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 1.8e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-7 PFAM
Pfam:7tm_1 41 290 3.9e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157618
Predicted Effect possibly damaging
Transcript: ENSMUST00000215984
AA Change: S160G

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Bicd1 A G 6: 149,517,005 T725A probably damaging Het
Cd1d2 A T 3: 86,988,540 I292F probably damaging Het
Cdk13 A G 13: 17,719,535 V495A probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Ctu2 A G 8: 122,480,910 E375G probably damaging Het
Dym T G 18: 75,230,165 I580S probably damaging Het
Eif3e A G 15: 43,251,547 L411P possibly damaging Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Enkur A G 2: 21,189,319 probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Frem2 G A 3: 53,516,857 A3053V probably benign Het
Gbgt1 T C 2: 28,498,423 L40P probably damaging Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gys2 G T 6: 142,456,422 D230E probably damaging Het
Herc2 T A 7: 56,169,018 probably null Het
Hps3 A T 3: 20,002,363 S815R probably benign Het
Igf1r C A 7: 68,201,962 S983R probably damaging Het
Itsn1 T A 16: 91,853,768 probably benign Het
Kcnc2 A G 10: 112,456,526 N91D probably damaging Het
Kif28 C A 1: 179,733,111 A210S possibly damaging Het
Klri2 T A 6: 129,740,309 Q37L probably damaging Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Mdn1 C A 4: 32,763,306 F5135L probably benign Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mst1r T C 9: 107,908,348 F402L probably damaging Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Nup188 T C 2: 30,336,924 probably benign Het
Olfr1243 C T 2: 89,527,937 V158I probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Prl2a1 T A 13: 27,806,386 probably null Het
Serpina9 T A 12: 103,998,264 I305F probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc19a1 C T 10: 77,042,486 T285I probably benign Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Srgap3 A G 6: 112,946,493 S2P probably damaging Het
Tcof1 A G 18: 60,837,901 V210A possibly damaging Het
Tex261 A G 6: 83,771,515 I136T probably benign Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ttn T C 2: 76,742,094 T26152A probably damaging Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn1r64 T C 7: 5,884,449 I32V probably benign Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Vps13b G A 15: 35,884,597 V3139I probably benign Het
Zfp628 T C 7: 4,920,831 V684A probably benign Het
Other mutations in Olfr870
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr870 APN 9 20171530 missense probably damaging 1.00
IGL01809:Olfr870 APN 9 20171295 missense probably damaging 1.00
IGL02130:Olfr870 APN 9 20171358 missense probably damaging 0.96
IGL03062:Olfr870 APN 9 20171167 missense probably damaging 1.00
IGL03133:Olfr870 APN 9 20170713 missense probably damaging 1.00
R0110:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0350:Olfr870 UTSW 9 20170736 nonsense probably null
R0417:Olfr870 UTSW 9 20171214 missense probably damaging 1.00
R0450:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0469:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R1169:Olfr870 UTSW 9 20171058 missense probably benign 0.04
R1728:Olfr870 UTSW 9 20170913 nonsense probably null
R1729:Olfr870 UTSW 9 20170913 nonsense probably null
R1776:Olfr870 UTSW 9 20170809 missense probably benign 0.16
R1784:Olfr870 UTSW 9 20170913 nonsense probably null
R1914:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1915:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1929:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R1936:Olfr870 UTSW 9 20171181 missense probably damaging 1.00
R2066:Olfr870 UTSW 9 20171554 missense probably benign 0.01
R2137:Olfr870 UTSW 9 20171167 missense probably damaging 1.00
R2270:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2271:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2272:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2509:Olfr870 UTSW 9 20171229 missense probably damaging 1.00
R2939:Olfr870 UTSW 9 20170765 missense probably benign
R2940:Olfr870 UTSW 9 20170765 missense probably benign
R3081:Olfr870 UTSW 9 20170765 missense probably benign
R4579:Olfr870 UTSW 9 20171114 missense probably damaging 1.00
R4667:Olfr870 UTSW 9 20171098 missense probably benign 0.04
R5681:Olfr870 UTSW 9 20170795 missense probably damaging 1.00
R5686:Olfr870 UTSW 9 20170969 missense possibly damaging 0.75
R5857:Olfr870 UTSW 9 20171239 missense probably damaging 1.00
R6561:Olfr870 UTSW 9 20170777 missense probably benign 0.01
R6842:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R6987:Olfr870 UTSW 9 20170834 missense probably benign 0.03
R7641:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R7674:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R8375:Olfr870 UTSW 9 20170741 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCGATAGATGAGACCCACAGGTAG -3'
(R):5'- CATGCTCTTTGGAGGCATGG -3'

Sequencing Primer
(F):5'- TGTTGATGGAATTCTCAAAATTGAAG -3'
(R):5'- CTTTGGAGGCATGGACACACTTC -3'
Posted On2014-10-15