Incidental Mutation 'R2221:Mst1r'
ID241501
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Namemacrophage stimulating 1 receptor (c-met-related tyrosine kinase)
SynonymsFv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
MMRRC Submission 040223-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R2221 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107906873-107920383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107908348 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 402 (F402L)
Ref Sequence ENSEMBL: ENSMUSP00000142201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
Predicted Effect probably damaging
Transcript: ENSMUST00000035203
AA Change: F402L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: F402L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158380
Predicted Effect probably damaging
Transcript: ENSMUST00000195617
AA Change: F402L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584
AA Change: F402L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Meta Mutation Damage Score 0.1158 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Bicd1 A G 6: 149,517,005 T725A probably damaging Het
Cd1d2 A T 3: 86,988,540 I292F probably damaging Het
Cdk13 A G 13: 17,719,535 V495A probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Ctu2 A G 8: 122,480,910 E375G probably damaging Het
Dym T G 18: 75,230,165 I580S probably damaging Het
Eif3e A G 15: 43,251,547 L411P possibly damaging Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Enkur A G 2: 21,189,319 probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Frem2 G A 3: 53,516,857 A3053V probably benign Het
Gbgt1 T C 2: 28,498,423 L40P probably damaging Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gys2 G T 6: 142,456,422 D230E probably damaging Het
Herc2 T A 7: 56,169,018 probably null Het
Hps3 A T 3: 20,002,363 S815R probably benign Het
Igf1r C A 7: 68,201,962 S983R probably damaging Het
Itsn1 T A 16: 91,853,768 probably benign Het
Kcnc2 A G 10: 112,456,526 N91D probably damaging Het
Kif28 C A 1: 179,733,111 A210S possibly damaging Het
Klri2 T A 6: 129,740,309 Q37L probably damaging Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Mdn1 C A 4: 32,763,306 F5135L probably benign Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Nup188 T C 2: 30,336,924 probably benign Het
Olfr1243 C T 2: 89,527,937 V158I probably benign Het
Olfr870 T C 9: 20,171,092 S160G possibly damaging Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Prl2a1 T A 13: 27,806,386 probably null Het
Serpina9 T A 12: 103,998,264 I305F probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc19a1 C T 10: 77,042,486 T285I probably benign Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Srgap3 A G 6: 112,946,493 S2P probably damaging Het
Tcof1 A G 18: 60,837,901 V210A possibly damaging Het
Tex261 A G 6: 83,771,515 I136T probably benign Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ttn T C 2: 76,742,094 T26152A probably damaging Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn1r64 T C 7: 5,884,449 I32V probably benign Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Vps13b G A 15: 35,884,597 V3139I probably benign Het
Zfp628 T C 7: 4,920,831 V684A probably benign Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1479:Mst1r UTSW 9 107913345 splice site probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1971:Mst1r UTSW 9 107913212 missense probably benign 0.06
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6220:Mst1r UTSW 9 107907348 missense probably benign 0.11
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
R7168:Mst1r UTSW 9 107908193 missense probably benign 0.01
R7299:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107915122 missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107920012 missense probably benign 0.05
R7684:Mst1r UTSW 9 107911563 missense probably benign 0.01
R7741:Mst1r UTSW 9 107907120 start gained probably benign
R7916:Mst1r UTSW 9 107907578 missense probably damaging 1.00
R8177:Mst1r UTSW 9 107907585 missense probably damaging 1.00
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCAGAGGGCCAGGAAGTG -3'
(R):5'- TATGACGTAAGCCCCTCCTC -3'

Sequencing Primer
(F):5'- AGGGCCAGGAAGTGCTTTTTG -3'
(R):5'- CCCTGGAAGCTATCTTAAAGAATCAG -3'
Posted On2014-10-15