Mutagenetix > Incidental Mutation

Incidental Mutation 'R2221:Mst1r'

241501

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

040223-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R2221 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107908348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 402 (F402L)

Ref Sequence

ENSEMBL: ENSMUSP00000142201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably damaging
Transcript: ENSMUST00000035203
AA Change: F402L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: F402L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158380

Predicted Effect

probably damaging
Transcript: ENSMUST00000195617
AA Change: F402L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584
AA Change: F402L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Meta Mutation Damage Score

0.1158

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,247,457		probably null	Het
Adamtsl1	A	C	4: 86,388,525	D1392A	probably benign	Het
Afdn	T	C	17: 13,883,737		probably benign	Het
Aph1b	A	T	9: 66,784,639	M121K	probably damaging	Het
Aspg	G	A	12: 112,114,434	A120T	probably damaging	Het
Bicd1	A	G	6: 149,517,005	T725A	probably damaging	Het
Cd1d2	A	T	3: 86,988,540	I292F	probably damaging	Het
Cdk13	A	G	13: 17,719,535	V495A	probably damaging	Het
Cfd	A	T	10: 79,892,205		probably null	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Cradd	A	C	10: 95,175,873	V135G	probably benign	Het
Cry1	A	G	10: 85,143,753	C460R	probably damaging	Het
Ctu2	A	G	8: 122,480,910	E375G	probably damaging	Het
Dym	T	G	18: 75,230,165	I580S	probably damaging	Het
Eif3e	A	G	15: 43,251,547	L411P	possibly damaging	Het
Emsy	T	C	7: 98,590,775	E1091G	possibly damaging	Het
Enkur	A	G	2: 21,189,319		probably benign	Het
Fam184a	G	A	10: 53,655,079	T733M	probably damaging	Het
Frem2	G	A	3: 53,516,857	A3053V	probably benign	Het
Gbgt1	T	C	2: 28,498,423	L40P	probably damaging	Het
Gm5174	T	A	10: 86,656,508		noncoding transcript	Het
Gys2	G	T	6: 142,456,422	D230E	probably damaging	Het
Herc2	T	A	7: 56,169,018		probably null	Het
Hps3	A	T	3: 20,002,363	S815R	probably benign	Het
Igf1r	C	A	7: 68,201,962	S983R	probably damaging	Het
Itsn1	T	A	16: 91,853,768		probably benign	Het
Kcnc2	A	G	10: 112,456,526	N91D	probably damaging	Het
Kif28	C	A	1: 179,733,111	A210S	possibly damaging	Het
Klri2	T	A	6: 129,740,309	Q37L	probably damaging	Het
Lrrc38	T	A	4: 143,369,849	C243*	probably null	Het
Map3k5	T	C	10: 20,067,920	V590A	possibly damaging	Het
Mdn1	C	A	4: 32,763,306	F5135L	probably benign	Het
Megf11	G	A	9: 64,660,431	G401S	possibly damaging	Het
Ntrk3	T	C	7: 78,198,852	I759V	probably damaging	Het
Nup188	T	C	2: 30,336,924		probably benign	Het
Olfr1243	C	T	2: 89,527,937	V158I	probably benign	Het
Olfr870	T	C	9: 20,171,092	S160G	possibly damaging	Het
Prdm2	T	C	4: 143,134,899	N607S	possibly damaging	Het
Prl2a1	T	A	13: 27,806,386		probably null	Het
Serpina9	T	A	12: 103,998,264	I305F	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc19a1	C	T	10: 77,042,486	T285I	probably benign	Het
Snap91	T	C	9: 86,792,527	T544A	possibly damaging	Het
Srgap3	A	G	6: 112,946,493	S2P	probably damaging	Het
Tcof1	A	G	18: 60,837,901	V210A	possibly damaging	Het
Tex261	A	G	6: 83,771,515	I136T	probably benign	Het
Trpa1	A	T	1: 14,903,256	F279L	probably null	Het
Ttc39b	T	C	4: 83,232,762	N532S	probably benign	Het
Ttn	T	C	2: 76,742,094	T26152A	probably damaging	Het
Ube2w	A	G	1: 16,597,959	S97P	possibly damaging	Het
Vmn1r25	A	C	6: 57,979,238	L22R	probably damaging	Het
Vmn1r64	T	C	7: 5,884,449	I32V	probably benign	Het
Vmn2r112	T	G	17: 22,601,233	M29R	possibly damaging	Het
Vmn2r71	T	A	7: 85,624,093	M705K	probably benign	Het
Vps13b	G	A	15: 35,884,597	V3139I	probably benign	Het
Zfp628	T	C	7: 4,920,831	V684A	probably benign	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTTCAGAGGGCCAGGAAGTG -3'
(R):5'- TATGACGTAAGCCCCTCCTC -3'

Sequencing Primer
(F):5'- AGGGCCAGGAAGTGCTTTTTG -3'
(R):5'- CCCTGGAAGCTATCTTAAAGAATCAG -3'

Posted On

2014-10-15