Incidental Mutation 'R2221:Fam184a'
ID241503
Institutional Source Beutler Lab
Gene Symbol Fam184a
Ensembl Gene ENSMUSG00000019856
Gene Namefamily with sequence similarity 184, member A
Synonyms4930438C08Rik, 4930589M24Rik, 3110012E06Rik
MMRRC Submission 040223-MU
Accession Numbers

Genbank: NM_001081428; MGI: 1923156

Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R2221 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53633145-53751123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53655079 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 733 (T733M)
Ref Sequence ENSEMBL: ENSMUSP00000020003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020003] [ENSMUST00000163761] [ENSMUST00000171807] [ENSMUST00000218659] [ENSMUST00000218682]
Predicted Effect probably damaging
Transcript: ENSMUST00000020003
AA Change: T733M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020003
Gene: ENSMUSG00000019856
AA Change: T733M

DomainStartEndE-ValueType
Pfam:FAM184 57 267 1.5e-84 PFAM
low complexity region 436 449 N/A INTRINSIC
Blast:HisKA 533 598 4e-6 BLAST
coiled coil region 656 788 N/A INTRINSIC
internal_repeat_2 795 864 2.49e-6 PROSPERO
internal_repeat_1 800 866 4.75e-7 PROSPERO
coiled coil region 960 983 N/A INTRINSIC
low complexity region 1101 1113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163761
AA Change: T677M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127400
Gene: ENSMUSG00000019856
AA Change: T677M

DomainStartEndE-ValueType
coiled coil region 4 88 N/A INTRINSIC
internal_repeat_1 99 167 6.86e-8 PROSPERO
internal_repeat_2 105 173 4e-7 PROSPERO
low complexity region 380 393 N/A INTRINSIC
Blast:HisKA 480 542 5e-6 BLAST
coiled coil region 600 732 N/A INTRINSIC
internal_repeat_2 739 808 4e-7 PROSPERO
internal_repeat_1 744 810 6.86e-8 PROSPERO
low complexity region 906 916 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165986
SMART Domains Protein: ENSMUSP00000128132
Gene: ENSMUSG00000019856

DomainStartEndE-ValueType
coiled coil region 9 40 N/A INTRINSIC
coiled coil region 102 166 N/A INTRINSIC
coiled coil region 212 235 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168949
Predicted Effect possibly damaging
Transcript: ENSMUST00000171807
AA Change: T329M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130315
Gene: ENSMUSG00000019856
AA Change: T329M

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
Pfam:DUF3090 64 159 5.9e-8 PFAM
low complexity region 303 343 N/A INTRINSIC
low complexity region 358 364 N/A INTRINSIC
internal_repeat_1 383 410 4.35e-5 PROSPERO
internal_repeat_1 424 451 4.35e-5 PROSPERO
low complexity region 648 660 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000218659
Predicted Effect probably damaging
Transcript: ENSMUST00000218682
AA Change: T130M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Bicd1 A G 6: 149,517,005 T725A probably damaging Het
Cd1d2 A T 3: 86,988,540 I292F probably damaging Het
Cdk13 A G 13: 17,719,535 V495A probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Ctu2 A G 8: 122,480,910 E375G probably damaging Het
Dym T G 18: 75,230,165 I580S probably damaging Het
Eif3e A G 15: 43,251,547 L411P possibly damaging Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Enkur A G 2: 21,189,319 probably benign Het
Frem2 G A 3: 53,516,857 A3053V probably benign Het
Gbgt1 T C 2: 28,498,423 L40P probably damaging Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gys2 G T 6: 142,456,422 D230E probably damaging Het
Herc2 T A 7: 56,169,018 probably null Het
Hps3 A T 3: 20,002,363 S815R probably benign Het
Igf1r C A 7: 68,201,962 S983R probably damaging Het
Itsn1 T A 16: 91,853,768 probably benign Het
Kcnc2 A G 10: 112,456,526 N91D probably damaging Het
Kif28 C A 1: 179,733,111 A210S possibly damaging Het
Klri2 T A 6: 129,740,309 Q37L probably damaging Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Mdn1 C A 4: 32,763,306 F5135L probably benign Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mst1r T C 9: 107,908,348 F402L probably damaging Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Nup188 T C 2: 30,336,924 probably benign Het
Olfr1243 C T 2: 89,527,937 V158I probably benign Het
Olfr870 T C 9: 20,171,092 S160G possibly damaging Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Prl2a1 T A 13: 27,806,386 probably null Het
Serpina9 T A 12: 103,998,264 I305F probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc19a1 C T 10: 77,042,486 T285I probably benign Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Srgap3 A G 6: 112,946,493 S2P probably damaging Het
Tcof1 A G 18: 60,837,901 V210A possibly damaging Het
Tex261 A G 6: 83,771,515 I136T probably benign Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ttn T C 2: 76,742,094 T26152A probably damaging Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn1r64 T C 7: 5,884,449 I32V probably benign Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Vps13b G A 15: 35,884,597 V3139I probably benign Het
Zfp628 T C 7: 4,920,831 V684A probably benign Het
Other mutations in Fam184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Fam184a APN 10 53694686 splice site probably benign
IGL01448:Fam184a APN 10 53698949 missense probably benign 0.19
IGL02052:Fam184a APN 10 53697120 unclassified probably benign
IGL02086:Fam184a APN 10 53699255 missense probably damaging 1.00
IGL02163:Fam184a APN 10 53647134 splice site probably null
IGL02247:Fam184a APN 10 53675160 missense probably damaging 1.00
IGL02316:Fam184a APN 10 53638239 missense probably damaging 1.00
IGL02493:Fam184a APN 10 53694693 critical splice donor site probably null
IGL02629:Fam184a APN 10 53698811 missense possibly damaging 0.80
IGL03006:Fam184a APN 10 53698697 missense probably damaging 1.00
2107:Fam184a UTSW 10 53641057 missense probably damaging 1.00
PIT4802001:Fam184a UTSW 10 53684354 nonsense probably null
R0427:Fam184a UTSW 10 53690115 missense probably damaging 1.00
R0477:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R0511:Fam184a UTSW 10 53698879 missense probably benign 0.03
R1322:Fam184a UTSW 10 53652319 missense probably damaging 1.00
R1422:Fam184a UTSW 10 53675208 missense probably benign 0.29
R1474:Fam184a UTSW 10 53635365 missense probably damaging 0.99
R1752:Fam184a UTSW 10 53674570 missense probably benign 0.02
R1831:Fam184a UTSW 10 53647084 missense probably damaging 0.97
R2186:Fam184a UTSW 10 53638194 missense probably damaging 1.00
R2202:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2203:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2223:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2261:Fam184a UTSW 10 53647570 critical splice donor site probably null
R2444:Fam184a UTSW 10 53640949 missense probably damaging 1.00
R3876:Fam184a UTSW 10 53699061 missense probably damaging 1.00
R3932:Fam184a UTSW 10 53699301 missense probably damaging 0.99
R4685:Fam184a UTSW 10 53698500 missense probably benign 0.39
R4953:Fam184a UTSW 10 53698805 missense probably benign 0.00
R5056:Fam184a UTSW 10 53674574 missense probably damaging 1.00
R5420:Fam184a UTSW 10 53633657 missense probably damaging 0.99
R6159:Fam184a UTSW 10 53698773 missense probably damaging 1.00
R6554:Fam184a UTSW 10 53640967 missense possibly damaging 0.95
R6714:Fam184a UTSW 10 53698883 missense probably benign 0.00
R6966:Fam184a UTSW 10 53654999 missense probably benign 0.34
R7034:Fam184a UTSW 10 53694814 missense possibly damaging 0.71
R7237:Fam184a UTSW 10 53634393 unclassified probably benign
R7253:Fam184a UTSW 10 53698805 missense probably benign 0.00
R7359:Fam184a UTSW 10 53699222 missense probably damaging 1.00
R7449:Fam184a UTSW 10 53698634 missense probably damaging 0.98
R7479:Fam184a UTSW 10 53655014 missense probably benign 0.01
R7725:Fam184a UTSW 10 53633706 nonsense probably null
R7726:Fam184a UTSW 10 53633706 nonsense probably null
R7881:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7886:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7896:Fam184a UTSW 10 53633706 nonsense probably null
R7897:Fam184a UTSW 10 53633706 nonsense probably null
R7964:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7969:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7979:Fam184a UTSW 10 53633706 nonsense probably null
R7980:Fam184a UTSW 10 53633706 nonsense probably null
R8049:Fam184a UTSW 10 53633706 nonsense probably null
Z1177:Fam184a UTSW 10 53699086 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACATTGGGCTGCATCTGG -3'
(R):5'- ATCAGACCTGTTGACCTGC -3'

Sequencing Primer
(F):5'- TTGGGCTGCATCTGGACCAC -3'
(R):5'- AGACCTGTTGACCTGCTCTTC -3'
Posted On2014-10-15