Mutagenetix > Incidental Mutations

Incidental Mutation 'R2221:Gm5174'

241507

Institutional Source

Beutler Lab

Gene Symbol

Gm5174

Ensembl Gene

ENSMUSG00000090308

Gene Name

predicted gene 5174

Synonyms

MMRRC Submission

040223-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R2221 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86655939-86657381 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 86656508 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171131

SMART Domains

Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

Domain	Start	End	E-Value	Type
S_TKc	14	262	5.59e-86	SMART
UBA	276	313	1.28e-3	SMART
low complexity region	447	462	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219608

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	T	7: 131,247,457		probably null	Het
Adamtsl1	A	C	4: 86,388,525	D1392A	probably benign	Het
Afdn	T	C	17: 13,883,737		probably benign	Het
Aph1b	A	T	9: 66,784,639	M121K	probably damaging	Het
Aspg	G	A	12: 112,114,434	A120T	probably damaging	Het
Bicd1	A	G	6: 149,517,005	T725A	probably damaging	Het
Cd1d2	A	T	3: 86,988,540	I292F	probably damaging	Het
Cdk13	A	G	13: 17,719,535	V495A	probably damaging	Het
Cfd	A	T	10: 79,892,205		probably null	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Cradd	A	C	10: 95,175,873	V135G	probably benign	Het
Cry1	A	G	10: 85,143,753	C460R	probably damaging	Het
Ctu2	A	G	8: 122,480,910	E375G	probably damaging	Het
Dym	T	G	18: 75,230,165	I580S	probably damaging	Het
Eif3e	A	G	15: 43,251,547	L411P	possibly damaging	Het
Emsy	T	C	7: 98,590,775	E1091G	possibly damaging	Het
Enkur	A	G	2: 21,189,319		probably benign	Het
Fam184a	G	A	10: 53,655,079	T733M	probably damaging	Het
Frem2	G	A	3: 53,516,857	A3053V	probably benign	Het
Gbgt1	T	C	2: 28,498,423	L40P	probably damaging	Het
Gys2	G	T	6: 142,456,422	D230E	probably damaging	Het
Herc2	T	A	7: 56,169,018		probably null	Het
Hps3	A	T	3: 20,002,363	S815R	probably benign	Het
Igf1r	C	A	7: 68,201,962	S983R	probably damaging	Het
Itsn1	T	A	16: 91,853,768		probably benign	Het
Kcnc2	A	G	10: 112,456,526	N91D	probably damaging	Het
Kif28	C	A	1: 179,733,111	A210S	possibly damaging	Het
Klri2	T	A	6: 129,740,309	Q37L	probably damaging	Het
Lrrc38	T	A	4: 143,369,849	C243*	probably null	Het
Map3k5	T	C	10: 20,067,920	V590A	possibly damaging	Het
Mdn1	C	A	4: 32,763,306	F5135L	probably benign	Het
Megf11	G	A	9: 64,660,431	G401S	possibly damaging	Het
Mst1r	T	C	9: 107,908,348	F402L	probably damaging	Het
Ntrk3	T	C	7: 78,198,852	I759V	probably damaging	Het
Nup188	T	C	2: 30,336,924		probably benign	Het
Olfr1243	C	T	2: 89,527,937	V158I	probably benign	Het
Olfr870	T	C	9: 20,171,092	S160G	possibly damaging	Het
Prdm2	T	C	4: 143,134,899	N607S	possibly damaging	Het
Prl2a1	T	A	13: 27,806,386		probably null	Het
Serpina9	T	A	12: 103,998,264	I305F	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc19a1	C	T	10: 77,042,486	T285I	probably benign	Het
Snap91	T	C	9: 86,792,527	T544A	possibly damaging	Het
Srgap3	A	G	6: 112,946,493	S2P	probably damaging	Het
Tcof1	A	G	18: 60,837,901	V210A	possibly damaging	Het
Tex261	A	G	6: 83,771,515	I136T	probably benign	Het
Trpa1	A	T	1: 14,903,256	F279L	probably null	Het
Ttc39b	T	C	4: 83,232,762	N532S	probably benign	Het
Ttn	T	C	2: 76,742,094	T26152A	probably damaging	Het
Ube2w	A	G	1: 16,597,959	S97P	possibly damaging	Het
Vmn1r25	A	C	6: 57,979,238	L22R	probably damaging	Het
Vmn1r64	T	C	7: 5,884,449	I32V	probably benign	Het
Vmn2r112	T	G	17: 22,601,233	M29R	possibly damaging	Het
Vmn2r71	T	A	7: 85,624,093	M705K	probably benign	Het
Vps13b	G	A	15: 35,884,597	V3139I	probably benign	Het
Zfp628	T	C	7: 4,920,831	V684A	probably benign	Het

Other mutations in Gm5174

Allele	Source	Chr	Coord	Type	Predicted Effect
Laco	UTSW	10	86656108	unclassified	noncoding transcript
R1083:Gm5174	UTSW	10	86656108	unclassified	noncoding transcript
R1199:Gm5174	UTSW	10	86657325	unclassified	noncoding transcript
R1296:Gm5174	UTSW	10	86657002	unclassified	noncoding transcript
R1715:Gm5174	UTSW	10	86656912	unclassified	noncoding transcript
R1957:Gm5174	UTSW	10	86656753	unclassified	noncoding transcript
R2223:Gm5174	UTSW	10	86656508	unclassified	noncoding transcript
R3104:Gm5174	UTSW	10	86656655	unclassified	noncoding transcript
R4165:Gm5174	UTSW	10	86656933	unclassified	noncoding transcript
R4166:Gm5174	UTSW	10	86656933	unclassified	noncoding transcript
R4243:Gm5174	UTSW	10	86656280	unclassified	noncoding transcript
R4244:Gm5174	UTSW	10	86656280	unclassified	noncoding transcript
R5024:Gm5174	UTSW	10	86656587	unclassified	noncoding transcript
R5292:Gm5174	UTSW	10	86656698	unclassified	noncoding transcript
R5586:Gm5174	UTSW	10	86656545	unclassified	noncoding transcript
R5864:Gm5174	UTSW	10	86657181	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- CCTCTGTCAAGTATTGTCACAAC -3'
(R):5'- AATGGATGGCCTCTTCTCAGG -3'

Sequencing Primer
(F):5'- GTCACAACCTTAATATTGTCCATCG -3'
(R):5'- CCTCTTCTCAGGGGGAACTGTG -3'

Posted On

2014-10-15