Incidental Mutation 'R2221:Aspg'
ID 241512
Institutional Source Beutler Lab
Gene Symbol Aspg
Ensembl Gene ENSMUSG00000037686
Gene Name asparaginase
Synonyms A530050D06Rik
MMRRC Submission 040223-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R2221 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 112073113-112093993 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 112080868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 120 (A120T)
Ref Sequence ENSEMBL: ENSMUSP00000078369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079400] [ENSMUST00000223184]
AlphaFold A0JNU3
Predicted Effect probably damaging
Transcript: ENSMUST00000079400
AA Change: A120T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078369
Gene: ENSMUSG00000037686
AA Change: A120T

DomainStartEndE-ValueType
Asparaginase 10 348 2.67e-111 SMART
ANK 396 426 4.05e2 SMART
ANK 430 459 4.46e-7 SMART
ANK 463 494 1.1e2 SMART
ANK 530 559 4.73e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221091
Predicted Effect probably benign
Transcript: ENSMUST00000223184
Predicted Effect probably benign
Transcript: ENSMUST00000223412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223457
Meta Mutation Damage Score 0.5187 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A C 4: 86,306,762 (GRCm39) D1392A probably benign Het
Afdn T C 17: 14,103,999 (GRCm39) probably benign Het
Aph1b A T 9: 66,691,921 (GRCm39) M121K probably damaging Het
Bicd1 A G 6: 149,418,503 (GRCm39) T725A probably damaging Het
Cd1d2 A T 3: 86,895,847 (GRCm39) I292F probably damaging Het
Cdcp3 A T 7: 130,849,186 (GRCm39) probably null Het
Cdk13 A G 13: 17,894,120 (GRCm39) V495A probably damaging Het
Cfd A T 10: 79,728,039 (GRCm39) probably null Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Cradd A C 10: 95,011,735 (GRCm39) V135G probably benign Het
Cry1 A G 10: 84,979,617 (GRCm39) C460R probably damaging Het
Ctu2 A G 8: 123,207,649 (GRCm39) E375G probably damaging Het
Dym T G 18: 75,363,236 (GRCm39) I580S probably damaging Het
Eif3e A G 15: 43,114,943 (GRCm39) L411P possibly damaging Het
Emsy T C 7: 98,239,982 (GRCm39) E1091G possibly damaging Het
Enkur A G 2: 21,194,130 (GRCm39) probably benign Het
Fam184a G A 10: 53,531,175 (GRCm39) T733M probably damaging Het
Frem2 G A 3: 53,424,278 (GRCm39) A3053V probably benign Het
Gbgt1 T C 2: 28,388,435 (GRCm39) L40P probably damaging Het
Gm5174 T A 10: 86,492,372 (GRCm39) noncoding transcript Het
Gys2 G T 6: 142,402,148 (GRCm39) D230E probably damaging Het
Herc2 T A 7: 55,818,766 (GRCm39) probably null Het
Hps3 A T 3: 20,056,527 (GRCm39) S815R probably benign Het
Igf1r C A 7: 67,851,710 (GRCm39) S983R probably damaging Het
Itsn1 T A 16: 91,650,656 (GRCm39) probably benign Het
Kcnc2 A G 10: 112,292,431 (GRCm39) N91D probably damaging Het
Kif28 C A 1: 179,560,676 (GRCm39) A210S possibly damaging Het
Klri2 T A 6: 129,717,272 (GRCm39) Q37L probably damaging Het
Lrrc38 T A 4: 143,096,419 (GRCm39) C243* probably null Het
Map3k5 T C 10: 19,943,666 (GRCm39) V590A possibly damaging Het
Mdn1 C A 4: 32,763,306 (GRCm39) F5135L probably benign Het
Megf11 G A 9: 64,567,713 (GRCm39) G401S possibly damaging Het
Mst1r T C 9: 107,785,547 (GRCm39) F402L probably damaging Het
Ntrk3 T C 7: 77,848,600 (GRCm39) I759V probably damaging Het
Nup188 T C 2: 30,226,936 (GRCm39) probably benign Het
Or4a71 C T 2: 89,358,281 (GRCm39) V158I probably benign Het
Or8b12i T C 9: 20,082,388 (GRCm39) S160G possibly damaging Het
Prdm2 T C 4: 142,861,469 (GRCm39) N607S possibly damaging Het
Prl2a1 T A 13: 27,990,369 (GRCm39) probably null Het
Serpina9 T A 12: 103,964,523 (GRCm39) I305F probably damaging Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc19a1 C T 10: 76,878,320 (GRCm39) T285I probably benign Het
Snap91 T C 9: 86,674,580 (GRCm39) T544A possibly damaging Het
Srgap3 A G 6: 112,923,454 (GRCm39) S2P probably damaging Het
Tcof1 A G 18: 60,970,973 (GRCm39) V210A possibly damaging Het
Tex261 A G 6: 83,748,497 (GRCm39) I136T probably benign Het
Trpa1 A T 1: 14,973,480 (GRCm39) F279L probably null Het
Ttc39b T C 4: 83,150,999 (GRCm39) N532S probably benign Het
Ttn T C 2: 76,572,438 (GRCm39) T26152A probably damaging Het
Ube2w A G 1: 16,668,183 (GRCm39) S97P possibly damaging Het
Vmn1r25 A C 6: 57,956,223 (GRCm39) L22R probably damaging Het
Vmn1r64 T C 7: 5,887,448 (GRCm39) I32V probably benign Het
Vmn2r112 T G 17: 22,820,214 (GRCm39) M29R possibly damaging Het
Vmn2r71 T A 7: 85,273,301 (GRCm39) M705K probably benign Het
Vps13b G A 15: 35,884,743 (GRCm39) V3139I probably benign Het
Zfp628 T C 7: 4,923,830 (GRCm39) V684A probably benign Het
Other mutations in Aspg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Aspg APN 12 112,089,387 (GRCm39) missense probably benign
IGL02199:Aspg APN 12 112,087,426 (GRCm39) missense probably benign 0.39
R0704:Aspg UTSW 12 112,080,906 (GRCm39) missense probably damaging 1.00
R0730:Aspg UTSW 12 112,078,693 (GRCm39) nonsense probably null
R1196:Aspg UTSW 12 112,082,958 (GRCm39) missense possibly damaging 0.94
R1270:Aspg UTSW 12 112,082,881 (GRCm39) missense probably damaging 1.00
R1466:Aspg UTSW 12 112,088,286 (GRCm39) missense probably benign 0.20
R1466:Aspg UTSW 12 112,088,286 (GRCm39) missense probably benign 0.20
R1592:Aspg UTSW 12 112,086,406 (GRCm39) missense probably benign 0.17
R1826:Aspg UTSW 12 112,089,852 (GRCm39) missense probably damaging 0.99
R1859:Aspg UTSW 12 112,087,606 (GRCm39) missense possibly damaging 0.86
R2124:Aspg UTSW 12 112,087,608 (GRCm39) missense probably benign 0.15
R2154:Aspg UTSW 12 112,087,408 (GRCm39) missense probably benign 0.01
R2190:Aspg UTSW 12 112,091,322 (GRCm39) missense probably damaging 0.96
R2223:Aspg UTSW 12 112,080,868 (GRCm39) missense probably damaging 1.00
R3907:Aspg UTSW 12 112,078,693 (GRCm39) nonsense probably null
R4234:Aspg UTSW 12 112,089,750 (GRCm39) nonsense probably null
R4258:Aspg UTSW 12 112,087,687 (GRCm39) missense probably benign 0.00
R4270:Aspg UTSW 12 112,087,629 (GRCm39) missense probably damaging 1.00
R4271:Aspg UTSW 12 112,087,629 (GRCm39) missense probably damaging 1.00
R5386:Aspg UTSW 12 112,089,466 (GRCm39) missense probably benign 0.01
R5431:Aspg UTSW 12 112,089,846 (GRCm39) missense probably benign 0.13
R5458:Aspg UTSW 12 112,086,436 (GRCm39) missense probably damaging 0.99
R5941:Aspg UTSW 12 112,079,519 (GRCm39) missense probably benign 0.02
R6003:Aspg UTSW 12 112,079,476 (GRCm39) missense probably damaging 1.00
R6057:Aspg UTSW 12 112,087,432 (GRCm39) missense probably damaging 0.96
R6928:Aspg UTSW 12 112,093,123 (GRCm39) missense possibly damaging 0.52
R6979:Aspg UTSW 12 112,087,378 (GRCm39) missense possibly damaging 0.77
R6998:Aspg UTSW 12 112,078,628 (GRCm39) missense probably damaging 1.00
R7054:Aspg UTSW 12 112,092,824 (GRCm39) missense probably damaging 0.98
R7060:Aspg UTSW 12 112,089,387 (GRCm39) missense probably benign
R7124:Aspg UTSW 12 112,089,417 (GRCm39) missense probably damaging 0.99
R7137:Aspg UTSW 12 112,078,632 (GRCm39) missense possibly damaging 0.92
R7439:Aspg UTSW 12 112,091,255 (GRCm39) missense possibly damaging 0.90
R7441:Aspg UTSW 12 112,091,255 (GRCm39) missense possibly damaging 0.90
R8922:Aspg UTSW 12 112,089,830 (GRCm39) missense possibly damaging 0.86
R9463:Aspg UTSW 12 112,089,824 (GRCm39) missense probably damaging 1.00
Z1176:Aspg UTSW 12 112,079,515 (GRCm39) missense possibly damaging 0.58
Z1177:Aspg UTSW 12 112,087,455 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATAAAAGATTGCCACACC -3'
(R):5'- CACTCTAGCCAGCAGGATACAG -3'

Sequencing Primer
(F):5'- CTACCGGCATCCCAGGC -3'
(R):5'- TACAGCAGGGATGGTGCC -3'
Posted On 2014-10-15