Incidental Mutation 'R2224:Mgam'
ID 241540
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission 040225-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R2224 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 40605765-40746057 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to T at 40741208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201148
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202775
Predicted Effect probably null
Transcript: ENSMUST00000202779
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202966
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,289,932 (GRCm39) L1416R probably damaging Het
Aen C A 7: 78,552,199 (GRCm39) T15K probably benign Het
Ahnak G A 19: 8,990,355 (GRCm39) probably benign Het
Ar T A X: 97,194,937 (GRCm39) M517K probably benign Het
Arsb T A 13: 93,930,679 (GRCm39) F216I probably damaging Het
Atg9b A G 5: 24,591,393 (GRCm39) V735A possibly damaging Het
Brinp3 C T 1: 146,777,658 (GRCm39) Q702* probably null Het
Btbd9 C A 17: 30,746,320 (GRCm39) A169S probably damaging Het
Cacna1h T C 17: 25,604,917 (GRCm39) N1132S probably benign Het
Ccdc33 A G 9: 57,989,305 (GRCm39) S123P probably damaging Het
Cep250 A C 2: 155,833,737 (GRCm39) E1886D possibly damaging Het
Chd9 A C 8: 91,737,913 (GRCm39) H1515P probably benign Het
Cyp2c68 A G 19: 39,724,026 (GRCm39) C213R probably benign Het
Ddx41 G A 13: 55,679,214 (GRCm39) T544I probably damaging Het
Dgkk T A X: 6,741,487 (GRCm39) D102E probably damaging Het
Eea1 T A 10: 95,855,874 (GRCm39) V637D probably damaging Het
Emcn T C 3: 137,109,778 (GRCm39) I140T possibly damaging Het
Exo1 A G 1: 175,714,254 (GRCm39) probably null Het
Fbxo21 T G 5: 118,146,188 (GRCm39) Y597D probably damaging Het
Fbxw20 G C 9: 109,062,650 (GRCm39) Q59E possibly damaging Het
Fpr3 T A 17: 18,191,455 (GRCm39) V242D probably damaging Het
Fyb1 A G 15: 6,681,864 (GRCm39) Y737C probably damaging Het
Gm17661 GG GGG 2: 90,748,052 (GRCm39) noncoding transcript Het
Hdac9 C T 12: 34,457,801 (GRCm39) V251I probably benign Het
Hoxa10 T C 6: 52,209,616 (GRCm39) E52G probably damaging Het
Il17f A G 1: 20,849,599 (GRCm39) V55A probably damaging Het
Inpp1 T A 1: 52,829,290 (GRCm39) E243V probably benign Het
Leap2 A G 11: 53,313,634 (GRCm39) L46P probably damaging Het
Map4k3 A T 17: 80,937,883 (GRCm39) D339E probably benign Het
Met A G 6: 17,563,721 (GRCm39) probably null Het
Mrgpra1 A G 7: 46,984,854 (GRCm39) V275A possibly damaging Het
Mrgprx2 T A 7: 48,132,608 (GRCm39) Q70L probably benign Het
Mtus1 C T 8: 41,535,812 (GRCm39) V635M probably damaging Het
Mup18 G T 4: 61,590,128 (GRCm39) F133L possibly damaging Het
Naalad2 A T 9: 18,287,829 (GRCm39) V267E possibly damaging Het
Nin A T 12: 70,108,004 (GRCm39) I196N probably damaging Het
Nkpd1 A T 7: 19,253,745 (GRCm39) Y37F probably benign Het
Odc1 A G 12: 17,597,336 (GRCm39) I13V probably benign Het
Or1ad1 T C 11: 50,876,059 (GRCm39) F177S probably damaging Het
Or4a67 A T 2: 88,597,930 (GRCm39) M243K possibly damaging Het
Or5m12 T A 2: 85,735,099 (GRCm39) I100F probably benign Het
Pard3 A G 8: 128,086,257 (GRCm39) I286V probably damaging Het
Pcx T C 19: 4,668,026 (GRCm39) I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 (GRCm39) R1081L probably benign Het
Prpf40b C T 15: 99,201,172 (GRCm39) probably benign Het
Rnmt C T 18: 68,438,854 (GRCm39) probably benign Het
Saxo5 A G 8: 3,529,249 (GRCm39) T245A probably benign Het
Sfxn1 A G 13: 54,239,536 (GRCm39) T20A possibly damaging Het
Sirt2 A G 7: 28,471,637 (GRCm39) probably null Het
Spata31d1a T A 13: 59,851,529 (GRCm39) I200L probably benign Het
Spin2g A T X: 33,656,599 (GRCm39) I171N possibly damaging Het
Tesl2 T A X: 23,825,173 (GRCm39) M1L probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tsbp1 C A 17: 34,667,737 (GRCm39) probably null Het
Uqcrc2 T A 7: 120,240,937 (GRCm39) V73E probably damaging Het
Vmn2r100 A G 17: 19,742,634 (GRCm39) K336R probably benign Het
Vmn2r108 A T 17: 20,701,295 (GRCm39) Y68* probably null Het
Zbtb4 C T 11: 69,667,184 (GRCm39) T163I probably benign Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40,619,944 (GRCm39) missense probably benign
IGL01065:Mgam APN 6 40,639,644 (GRCm39) critical splice donor site probably null
IGL01402:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01404:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01413:Mgam APN 6 40,638,211 (GRCm39) missense probably damaging 1.00
IGL01546:Mgam APN 6 40,631,627 (GRCm39) missense probably damaging 0.98
IGL01596:Mgam APN 6 40,635,204 (GRCm39) missense probably damaging 1.00
IGL02133:Mgam APN 6 40,620,010 (GRCm39) missense probably damaging 0.98
IGL02734:Mgam APN 6 40,639,628 (GRCm39) missense probably damaging 1.00
BB002:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
BB012:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R0012:Mgam UTSW 6 40,742,190 (GRCm39) splice site probably null
R0116:Mgam UTSW 6 40,635,921 (GRCm39) missense probably damaging 1.00
R0310:Mgam UTSW 6 40,737,969 (GRCm39) splice site probably benign
R0452:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
R0497:Mgam UTSW 6 40,641,826 (GRCm39) missense probably damaging 1.00
R0699:Mgam UTSW 6 40,619,953 (GRCm39) missense possibly damaging 0.84
R0738:Mgam UTSW 6 40,731,869 (GRCm39) missense probably benign 0.01
R1033:Mgam UTSW 6 40,657,558 (GRCm39) missense probably benign 0.07
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1430:Mgam UTSW 6 40,733,305 (GRCm39) missense probably benign 0.08
R1432:Mgam UTSW 6 40,733,301 (GRCm39) missense probably damaging 1.00
R1443:Mgam UTSW 6 40,736,714 (GRCm39) nonsense probably null
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1519:Mgam UTSW 6 40,638,617 (GRCm39) missense probably benign 0.45
R1654:Mgam UTSW 6 40,734,421 (GRCm39) missense probably damaging 1.00
R1667:Mgam UTSW 6 40,653,978 (GRCm39) missense possibly damaging 0.62
R1730:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1781:Mgam UTSW 6 40,646,797 (GRCm39) missense probably damaging 1.00
R1783:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1829:Mgam UTSW 6 40,643,826 (GRCm39) missense probably damaging 1.00
R1833:Mgam UTSW 6 40,631,652 (GRCm39) critical splice donor site probably null
R1872:Mgam UTSW 6 40,638,234 (GRCm39) nonsense probably null
R1912:Mgam UTSW 6 40,741,119 (GRCm39) nonsense probably null
R1977:Mgam UTSW 6 40,641,814 (GRCm39) missense probably benign 0.01
R2048:Mgam UTSW 6 40,633,363 (GRCm39) missense possibly damaging 0.80
R2086:Mgam UTSW 6 40,737,962 (GRCm39) splice site probably null
R2138:Mgam UTSW 6 40,733,384 (GRCm39) missense probably damaging 1.00
R2408:Mgam UTSW 6 40,663,456 (GRCm39) missense probably damaging 1.00
R2508:Mgam UTSW 6 40,736,717 (GRCm39) missense probably damaging 1.00
R2842:Mgam UTSW 6 40,638,279 (GRCm39) missense probably benign 0.01
R2847:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2848:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2965:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R2966:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R3035:Mgam UTSW 6 40,640,464 (GRCm39) missense probably benign
R3895:Mgam UTSW 6 40,736,054 (GRCm39) missense probably damaging 1.00
R4027:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4030:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4302:Mgam UTSW 6 40,740,019 (GRCm39) missense probably benign 0.02
R4707:Mgam UTSW 6 40,691,566 (GRCm39) splice site probably null
R4826:Mgam UTSW 6 40,657,582 (GRCm39) missense possibly damaging 0.52
R4898:Mgam UTSW 6 40,619,988 (GRCm39) missense probably benign
R5438:Mgam UTSW 6 40,661,455 (GRCm39) missense probably damaging 1.00
R5492:Mgam UTSW 6 40,733,297 (GRCm39) missense probably damaging 1.00
R5770:Mgam UTSW 6 40,646,738 (GRCm39) missense probably benign 0.01
R5839:Mgam UTSW 6 40,716,998 (GRCm39) missense possibly damaging 0.90
R5845:Mgam UTSW 6 40,652,257 (GRCm39) missense possibly damaging 0.78
R5847:Mgam UTSW 6 40,660,989 (GRCm39) missense probably benign 0.42
R5891:Mgam UTSW 6 40,721,282 (GRCm39) missense probably benign
R6158:Mgam UTSW 6 40,734,648 (GRCm39) missense probably damaging 1.00
R6193:Mgam UTSW 6 40,724,854 (GRCm39) nonsense probably null
R6423:Mgam UTSW 6 40,653,979 (GRCm39) missense possibly damaging 0.84
R6706:Mgam UTSW 6 40,721,720 (GRCm39) missense probably benign 0.00
R6813:Mgam UTSW 6 40,727,099 (GRCm39) missense probably damaging 0.99
R6863:Mgam UTSW 6 40,705,943 (GRCm39) missense probably benign 0.00
R6906:Mgam UTSW 6 40,724,853 (GRCm39) missense probably damaging 1.00
R7091:Mgam UTSW 6 40,745,210 (GRCm39) missense possibly damaging 0.95
R7099:Mgam UTSW 6 40,638,650 (GRCm39) missense probably benign 0.09
R7282:Mgam UTSW 6 40,740,045 (GRCm39) missense probably benign
R7282:Mgam UTSW 6 40,633,446 (GRCm39) missense possibly damaging 0.71
R7354:Mgam UTSW 6 40,721,732 (GRCm39) missense probably damaging 1.00
R7374:Mgam UTSW 6 40,734,373 (GRCm39) missense possibly damaging 0.89
R7399:Mgam UTSW 6 40,643,788 (GRCm39) missense probably damaging 0.99
R7406:Mgam UTSW 6 40,640,459 (GRCm39) missense probably benign 0.13
R7446:Mgam UTSW 6 40,723,266 (GRCm39) missense probably damaging 1.00
R7466:Mgam UTSW 6 40,721,723 (GRCm39) missense probably benign 0.00
R7525:Mgam UTSW 6 40,742,954 (GRCm39) missense probably benign 0.01
R7530:Mgam UTSW 6 40,686,152 (GRCm39) splice site probably null
R7570:Mgam UTSW 6 40,723,367 (GRCm39) missense probably benign 0.16
R7669:Mgam UTSW 6 40,635,944 (GRCm39) missense probably benign 0.00
R7679:Mgam UTSW 6 40,619,980 (GRCm39) missense probably damaging 0.98
R7746:Mgam UTSW 6 40,645,127 (GRCm39) missense probably damaging 0.99
R7859:Mgam UTSW 6 40,717,113 (GRCm39) missense possibly damaging 0.75
R7925:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R8206:Mgam UTSW 6 40,657,169 (GRCm39) missense probably benign 0.00
R8244:Mgam UTSW 6 40,727,520 (GRCm39) missense probably damaging 1.00
R8309:Mgam UTSW 6 40,722,111 (GRCm39) missense possibly damaging 0.88
R8472:Mgam UTSW 6 40,671,460 (GRCm39) splice site probably null
R8758:Mgam UTSW 6 40,705,977 (GRCm39) missense probably benign 0.41
R8777:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8783:Mgam UTSW 6 40,633,423 (GRCm39) missense probably damaging 0.99
R8939:Mgam UTSW 6 40,740,137 (GRCm39) critical splice donor site probably null
R8968:Mgam UTSW 6 40,734,745 (GRCm39) critical splice acceptor site probably null
R8987:Mgam UTSW 6 40,706,570 (GRCm39) missense probably damaging 1.00
R9055:Mgam UTSW 6 40,691,663 (GRCm39) intron probably benign
R9171:Mgam UTSW 6 40,745,146 (GRCm39) missense possibly damaging 0.76
R9252:Mgam UTSW 6 40,706,577 (GRCm39) missense probably damaging 0.99
R9258:Mgam UTSW 6 40,657,121 (GRCm39) missense probably benign
R9262:Mgam UTSW 6 40,723,422 (GRCm39) critical splice donor site probably null
R9287:Mgam UTSW 6 40,705,905 (GRCm39) intron probably benign
R9521:Mgam UTSW 6 40,722,118 (GRCm39) missense probably damaging 1.00
R9589:Mgam UTSW 6 40,727,519 (GRCm39) missense probably damaging 1.00
R9658:Mgam UTSW 6 40,721,311 (GRCm39) missense possibly damaging 0.93
R9784:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
RF011:Mgam UTSW 6 40,734,370 (GRCm39) missense probably damaging 1.00
RF020:Mgam UTSW 6 40,662,243 (GRCm39) missense probably damaging 1.00
RF023:Mgam UTSW 6 40,657,642 (GRCm39) missense probably benign
X0021:Mgam UTSW 6 40,635,981 (GRCm39) missense probably damaging 1.00
Z1088:Mgam UTSW 6 40,619,994 (GRCm39) missense probably benign 0.01
Z1176:Mgam UTSW 6 40,706,000 (GRCm39) missense probably damaging 1.00
Z1176:Mgam UTSW 6 40,654,578 (GRCm39) critical splice donor site probably null
Z1177:Mgam UTSW 6 40,717,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAAGAACTTCATTTTGCTC -3'
(R):5'- TCCTAAGAGGGTGCCATCTC -3'

Sequencing Primer
(F):5'- GGAAGAACTTCATTTTGCTCCTTTG -3'
(R):5'- GAGGGTGCCATCTCCCATAAACTC -3'
Posted On 2014-10-15