Incidental Mutation 'R2224:Olfr1377'
ID241559
Institutional Source Beutler Lab
Gene Symbol Olfr1377
Ensembl Gene ENSMUSG00000061952
Gene Nameolfactory receptor 1377
SynonymsMOR129-1, GA_x6K02T2QP88-4453480-4452557
MMRRC Submission 040225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2224 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50981967-50986593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50985232 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 177 (F177S)
Ref Sequence ENSEMBL: ENSMUSP00000151087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075177] [ENSMUST00000213291] [ENSMUST00000216101]
Predicted Effect probably damaging
Transcript: ENSMUST00000075177
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074672
Gene: ENSMUSG00000061952
AA Change: F177S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-51 PFAM
Pfam:7tm_1 41 289 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204581
AA Change: F177S
SMART Domains Protein: ENSMUSP00000144855
Gene: ENSMUSG00000061952
AA Change: F177S

DomainStartEndE-ValueType
Pfam:7tm_4 31 237 5.9e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.9e-4 PFAM
Pfam:7tm_1 41 235 1.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213291
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216101
AA Change: F177S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,472,068 L1416R probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Ahnak G A 19: 9,012,991 probably benign Het
Ar T A X: 98,151,331 M517K probably benign Het
Arsb T A 13: 93,794,171 F216I probably damaging Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BC051142 C A 17: 34,448,763 probably null Het
Brinp3 C T 1: 146,901,920 Q702* probably null Het
Btbd9 C A 17: 30,527,346 A169S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep250 A C 2: 155,991,817 E1886D possibly damaging Het
Chd9 A C 8: 91,011,285 H1515P probably benign Het
Cyp2c68 A G 19: 39,735,582 C213R probably benign Het
Ddx41 G A 13: 55,531,401 T544I probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Eea1 T A 10: 96,020,012 V637D probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exo1 A G 1: 175,886,688 probably null Het
Fbxo21 T G 5: 118,008,123 Y597D probably damaging Het
Fbxw20 G C 9: 109,233,582 Q59E possibly damaging Het
Fpr3 T A 17: 17,971,193 V242D probably damaging Het
Fyb A G 15: 6,652,383 Y737C probably damaging Het
Gm17661 GG GGG 2: 90,917,708 noncoding transcript Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17f A G 1: 20,779,375 V55A probably damaging Het
Inpp1 T A 1: 52,790,131 E243V probably benign Het
Leap2 A G 11: 53,422,807 L46P probably damaging Het
Map4k3 A T 17: 80,630,454 D339E probably benign Het
Met A G 6: 17,563,722 probably null Het
Mgam G T 6: 40,764,274 probably null Het
Mrgpra1 A G 7: 47,335,106 V275A possibly damaging Het
Mrgprx2 T A 7: 48,482,860 Q70L probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Mup18 G T 4: 61,671,891 F133L possibly damaging Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nin A T 12: 70,061,230 I196N probably damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Odc1 A G 12: 17,547,335 I13V probably benign Het
Olfr1024 T A 2: 85,904,755 I100F probably benign Het
Olfr1200 A T 2: 88,767,586 M243K possibly damaging Het
Pard3 A G 8: 127,359,776 I286V probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Prpf40b C T 15: 99,303,291 probably benign Het
Rnmt C T 18: 68,305,783 probably benign Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sirt2 A G 7: 28,772,212 probably null Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uqcrc2 T A 7: 120,641,714 V73E probably damaging Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zbtb4 C T 11: 69,776,358 T163I probably benign Het
Other mutations in Olfr1377
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1377 APN 11 50985003 missense possibly damaging 0.94
R1386:Olfr1377 UTSW 11 50985367 missense probably damaging 0.97
R1486:Olfr1377 UTSW 11 50984781 missense probably benign 0.00
R1613:Olfr1377 UTSW 11 50985218 missense probably damaging 1.00
R2411:Olfr1377 UTSW 11 50984931 missense probably damaging 0.98
R3014:Olfr1377 UTSW 11 50984707 missense probably benign 0.00
R4080:Olfr1377 UTSW 11 50984856 missense probably damaging 1.00
R4753:Olfr1377 UTSW 11 50985151 missense probably benign 0.05
R4764:Olfr1377 UTSW 11 50984775 missense probably benign 0.00
R4822:Olfr1377 UTSW 11 50985083 nonsense probably null
R4865:Olfr1377 UTSW 11 50985543 missense probably damaging 0.99
R5053:Olfr1377 UTSW 11 50985310 missense probably damaging 1.00
R6054:Olfr1377 UTSW 11 50984804 missense probably benign 0.00
R6368:Olfr1377 UTSW 11 50984786 missense probably benign 0.00
R7589:Olfr1377 UTSW 11 50985030 missense probably damaging 0.98
R7843:Olfr1377 UTSW 11 50985018 missense probably benign 0.06
R8056:Olfr1377 UTSW 11 50985541 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAACATGGATGGCTTCCTCC -3'
(R):5'- ACATGTAGACAGGGCTTTCC -3'

Sequencing Primer
(F):5'- CCTGAGTGTGATGGCCTATGACC -3'
(R):5'- ACATGTAGACAGGGCTTTCCTTATC -3'
Posted On2014-10-15