Incidental Mutation 'R2224:Spata31d1a'
ID241567
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission 040225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2224 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59703715 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 200 (I200L)
Ref Sequence ENSEMBL: ENSMUSP00000152919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect probably benign
Transcript: ENSMUST00000066510
AA Change: I200L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876
AA Change: I200L

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect probably benign
Transcript: ENSMUST00000224982
AA Change: I200L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225362
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,472,068 L1416R probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Ahnak G A 19: 9,012,991 probably benign Het
Ar T A X: 98,151,331 M517K probably benign Het
Arsb T A 13: 93,794,171 F216I probably damaging Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BC051142 C A 17: 34,448,763 probably null Het
Brinp3 C T 1: 146,901,920 Q702* probably null Het
Btbd9 C A 17: 30,527,346 A169S probably damaging Het
Cacna1h T C 17: 25,385,943 N1132S probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep250 A C 2: 155,991,817 E1886D possibly damaging Het
Chd9 A C 8: 91,011,285 H1515P probably benign Het
Cyp2c68 A G 19: 39,735,582 C213R probably benign Het
Ddx41 G A 13: 55,531,401 T544I probably damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Eea1 T A 10: 96,020,012 V637D probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exo1 A G 1: 175,886,688 probably null Het
Fbxo21 T G 5: 118,008,123 Y597D probably damaging Het
Fbxw20 G C 9: 109,233,582 Q59E possibly damaging Het
Fpr3 T A 17: 17,971,193 V242D probably damaging Het
Fyb A G 15: 6,652,383 Y737C probably damaging Het
Gm17661 GG GGG 2: 90,917,708 noncoding transcript Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17f A G 1: 20,779,375 V55A probably damaging Het
Inpp1 T A 1: 52,790,131 E243V probably benign Het
Leap2 A G 11: 53,422,807 L46P probably damaging Het
Map4k3 A T 17: 80,630,454 D339E probably benign Het
Met A G 6: 17,563,722 probably null Het
Mgam G T 6: 40,764,274 probably null Het
Mrgpra1 A G 7: 47,335,106 V275A possibly damaging Het
Mrgprx2 T A 7: 48,482,860 Q70L probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Mup18 G T 4: 61,671,891 F133L possibly damaging Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nin A T 12: 70,061,230 I196N probably damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Odc1 A G 12: 17,547,335 I13V probably benign Het
Olfr1024 T A 2: 85,904,755 I100F probably benign Het
Olfr1200 A T 2: 88,767,586 M243K possibly damaging Het
Olfr1377 T C 11: 50,985,232 F177S probably damaging Het
Pard3 A G 8: 127,359,776 I286V probably damaging Het
Pcx T C 19: 4,617,998 I516T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Prpf40b C T 15: 99,303,291 probably benign Het
Rnmt C T 18: 68,305,783 probably benign Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Sirt2 A G 7: 28,772,212 probably null Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uqcrc2 T A 7: 120,641,714 V73E probably damaging Het
Vmn2r100 A G 17: 19,522,372 K336R probably benign Het
Vmn2r108 A T 17: 20,481,033 Y68* probably null Het
Zbtb4 C T 11: 69,776,358 T163I probably benign Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 splice site probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
R7271:Spata31d1a UTSW 13 59702099 missense probably benign 0.00
R7346:Spata31d1a UTSW 13 59703201 missense probably benign
R7556:Spata31d1a UTSW 13 59701984 missense probably benign 0.00
R7581:Spata31d1a UTSW 13 59704139 critical splice donor site probably null
R7891:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
R7995:Spata31d1a UTSW 13 59701110 missense probably benign 0.06
R8379:Spata31d1a UTSW 13 59702854 missense probably benign 0.00
R8497:Spata31d1a UTSW 13 59701174 missense possibly damaging 0.91
Z1177:Spata31d1a UTSW 13 59703085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCAGTTGAGACACTGGG -3'
(R):5'- AGCAAGCACTCAGGTCAGAC -3'

Sequencing Primer
(F):5'- TCCCTAGGGCTTTCCACGG -3'
(R):5'- GGTCAGACACCTGCTCTCTCAG -3'
Posted On2014-10-15